US07864554B2

A circuit for reducing the variations of auto-supply voltage of a control circuit of a switching power supply, where the control circuit supplies an activation or deactivation signal of a power transistor, includes an auto-supply voltage generator, a controlled switch capable of selectively connecting the generator to the control circuit, and a driving circuit of the controlled switch that supplies a closing signal of the controlled switch after a predefined delay of time starting from the deactivation command.
US07864551B2

A power supply device with a system switch circuit includes a primary power system, a stationary power system and a power management unit. The power management unit is triggered by a remote ON/OFF signal to generate a bias voltage power for turning on the primary power system after obtaining a stationary power. The system switch circuit is triggered by the remote ON/OFF signal to interrupt the stationary power system from obtaining an electric power path of an input power or a reference frequency signal to interrupt the stationary power, and triggered by the remote ON/OFF signal again to conduct the stationary power system to obtain the electric power path of the input power or the reference frequency signal to generate the stationary power, so as to achieve the effects of reducing a power loss as well as maintaining a normal operation of the power supply device.
US07864550B2

A power adapter with voltage-stabilized compensation includes a pulse frequency modulation circuit to generate a driving pulse which has a variable OFF time interval to control power transformed and output by a transformer. The power adapter also has an ancillary coil to induce a feedback signal on the secondary coil of the transformer. The pulse frequency modulation circuit includes a time interval modulation unit to receive the feedback signal and a feedback compensation unit. The time interval modulation unit sets a level voltage compared with the feedback signal to generate a sample signal to modulate the OFF time interval. The feedback compensation unit provides a compensation signal to the time interval modulation unit to change the size of the feedback signal or sample signal thereby to compensate the voltage output from the secondary side.
US07864546B2

A power converter comprises a direct current (DC)-DC converter configured to receive an input voltage in a primary domain, a transformer coupled to and driven by the DC-DC converter and supplying an output voltage in a secondary domain, and a transmission path configured to pass a digital feedback signal through an isolation barrier from the secondary domain to the primary domain.
US07864541B2

A method according to one embodiment may include providing a baffle assembly comprising at least one airflow control zone with an airflow resistance. The method of this embodiment may also include positioning said baffle assembly in a flow of air through a chassis. Of course, many alternatives, variations, and modifications are possible without departing from this embodiment.
US07864538B2

A slide apparatus that provides horizontal support to a disc drive blade is described. The slide apparatus essentially includes a slider beam, a guide rail, a chassis and a retaining member. The slider beam possesses a slotted feature that extends at least partially along the length of the slider beam. The guide rail, which is adapted to be attached to a frame, constrains the slider beam to move only along the length of the guide rail. A retaining member is anchored to the chassis and extends into said slotted feature. The chassis, which supports the disc drive blade, is confined by the retaining member to move essentially only along the slotted feature in the slider beam.
US07864534B2

An electronics enclosure is provided. The electronics enclosure includes a heat dissipating body comprising: a heat conducting surface, a first flange adjacent to the heat conducting surface, and a first part of a latch mechanism adjacent to the heat conducting surface. The first part of the latch mechanism is adjacent an edge of the heat conducting surface opposite to the first flange, such that a portion of the heat conducting surface is between the first flange and the first part of the latch mechanism. The electronics enclosure also includes a plurality of electronic modules configured to mount to the heat dissipating body. Each of the plurality of electronic modules comprises: a plurality of electronic components, a heat conducting side configured to contact the heat conducting surface of the heat dissipating body, a second flange adjacent the heat conducting side, the second flange configured to couple with the first flange, and a second part of the latch mechanism adjacent the heat conducting side, the second part of the latch mechanism configured to couple with the first part of the latch mechanism. The second flange and the second part of the latch mechanism are on opposite edges of the heat conducting side.
US07864526B2

A heat dissipation device for cooling an electronic device mounted on a printed circuited board includes a heat sink thermally contacting the electronic device, a fan defining a plurality of through holes in a periphery thereof and a fixing device fixing the fan on a side of the heat sink. A plurality of fasteners are attached on a bottom of the heat sink and fasten the heat sink on the printed circuited board. The fasteners block the through holes in a bottom of the fan. The fixing device includes fixing brackets attached to the heat sink and a plurality of resilient connecting devices. Each resilient connecting device has an end extending through a corresponding through hole in the bottom of the fan and connected to the fan, and another end connected to a bottom of a corresponding fixing bracket.
US07864506B2

Film capacitor assembly has a plurality of film capacitive layers for storing an electric charge. The plurality of film capacitive layers have a first metal contact and a second metal contact. A heat sink removes heat from the plurality of film capacitive layers. The heat sink is in thermal conductive communication with at least one of the first metal contact and the second metal contact. A dielectric material is configured to prevent a transmission of electric current through the heat sink from the plurality of film capacitor capacitive layers.
US07864495B2

In a disclosed excess voltage protection circuit, when the input voltage equal to or higher than a predetermined maximum voltage is detected by an excess voltage detection circuit, a switching element is shut off so as to prevent the input voltage being output from the excess voltage protection circuit. A voltage obtained by dividing the input voltage using resistors is output from the excess voltage protection circuit.
US07864489B2

Provided is a thin-film magnetic head in which a noise due to the voltage potential difference between the read head element and the protective coat surface is suppressed. The thin-film magnetic head comprises: a read head element, one end surface of the read head element reaching an head end surface on the ABS side; a protective coat formed on the head end surface in such a way to cover at least the one end surface of the read head element; and at least one antistatic means for preventing the protective coat from being electrostatically charged, formed on/above the element formation surface, one end surface of the at least one antistatic means reaching the head end surface, the protective coat covering a portion, not the whole, of the one end surface of the at least one antistatic means on the head end surface.
US07864487B2

A servo write head is provided and is configured to simultaneously write at least two servo patterns in respective servo bands on linear magnetic tape. Centerlines of the servo patterns are substantially uniformly spaced in the lateral direction. In addition, the servo patterns of all adjacent respective servo bands are displaced relative to each other in a longitudinal direction by an amount that is related to a length of a servo frame and a type of the servo patterns.
US07864483B2

A hard disk drive and its circuit board and an integrated circuit are disclosed using two piezoelectric devices each having one terminal used to generate signal. The first signal goes to one input of a differential amplifier. The second signal goes to an amplifier whose gain is controlled to create an amplified second signal for the differential amplifier whose output and the first and second signals create a selected signal received by an A/D converter to create a sampled signal used to create a linear disturbance signal and/or a rotational compensation signal, which in turn are used to control the gain of the amplifier to minimize a PES envelope and/or a harmonic PES envelope either in calibration or normal operation of the hard disk drive.
US07864481B1

A method of writing a spiral track on a disk of a disk drive is disclosed. A plurality of reference tracks are written on the disk. A head is moved over the reference tracks to generate a read signal comprising a plurality of peak signals, wherein each peak signal corresponds to a reference track crossing. At least one of a starting radial location and a velocity profile is adjusted in response to a distribution of the peak signals, and the spiral track is written on the disk using the starting radial location and the velocity profile. In one embodiment, the distribution of the peak signals represents a uniform and a non-uniform expansion of a mechanical component.
US07864480B2

A system includes a control module and an estimating module. The control module controls a speed of an actuator arm when the actuator arm moves from a parked position to an edge of a rotating storage medium and generates an arm control signal. The estimating module estimates a force to move the actuator arm based on the arm control signal and the speed, and generates an estimated force signal that adjusts the arm control signal.
US07864472B1

A data storage device has a housing having a size and shape compatible with being inserted into a floppy disk drive. A data storage unit is provided within the housing for storing a plurality of floppy disk data images. A rotating hub is mounted in the housing to receive the spindle driven by the floppy disk drive. The rotating hub has a position encoder for generating a hub position signal. A transducer is mounted to the housing spanning a range of motion of the read/write head of the floppy disk drive. A head position sensor is mounted to the housing for generating a head position signal in response to a sensed location of the read/write head. A controller within the housing is responsive to the hub position signal and the head position signal to identify a position within a sector of a selected one of the floppy disk data images and to exchange data between the transducer and the identified position of the selected floppy disk data image in the data storage unit.
US07864461B2

A camera module includes a rear lens barrel, a front lens barrel assembled to the rear lens barrel, the front lens barrel and the rear lens barrel together forming a housing space, a lens holder that holds an imaging optical system and is housed in the housing space, a guiding mechanism that movably supports the lens holder along the optical axis of the imaging optical system, and a driving unit that moves the lens holder along the optical axis of the imaging optical system, the driving unit including a magnet provided in the lens holder and a coil that faces the magnet. The rear lens barrel has a bottom wall that faces the housing space. The coil includes first and second coils disposed in the rear lens barrel on opposite sides of the optical axis in the housing space.
US07864449B2

A negative refraction photonic crystal lens is provided. The negative refraction photonic crystal lens includes a substrate and a plurality of voids periodically distributed in the substrate. The voids are configured extending along a direction longitudinally perpendicular with an incident direction of a light having a specific wavelength. By suitably selecting a refractive index of the substrate, a radius of the voids, and a lattice parameter of the voids, the negative refraction photonic crystal lens presents a negative refraction characteristic with respect to the specific wavelength, in that the light incident from one side of the substrate can be focused at the other side of the substrate, thus configuring an optical lens. The optical lens is adapted for not only achieving an optimal sub-wavelength focusing performance, but also further improving the imaging resolution of the negative refraction photonic crystal lens by employing an anisotropic material for preparing the substrate.
US07864445B2

A zoom lens which includes in order from an object side to an image side: a first lens unit with a positive refractive power; a second lens unit with a negative refractive power; and a subsequent lens unit. The second lens unit moves on an optical axis to increase an interval between the first and second lens units during zooming from a wide angle end to a telephoto end. The first lens unit includes a front side lens subunit immovable during focusing with a positive refractive power and a rear side lens subunit movable during focusing with a positive refractive power. A PR lens of the rear side lens subunit and a N2 lens of the second lens unit are made of a material wherein an Abbe number (νd) and a partial dispersion ratio (θgF) are suitably set.
US07864441B2

A zoom lens is such that spacings between a plurality of lens units are properly changed and thereby the magnification of the zoom lens is changed. The most object-side lens unit of this zoom lens has a positive refracting power and comprises, in order from an object side, a negative lens, a reflecting member for changing an optical path, and a positive lens, without cementing the reflecting member and the positive lens as well as the reflecting member and the negative lens, and at least one of surfaces of the negative lens and the positive lens is configured as an aspherical surface to satisfy the following condition: 0.0001<|Y49|/ihw<0.1 where Y49 is an aspherical amount of the aspherical surface at a position where a chief ray of light incident on the most object-side lens unit at an angle of 49° with the optical axis is incident on a most object-side aspherical surface in the lens unit and ihw is an image height at a wide-angle position.
US07864439B1

Disclosed is an electrowetting-based apparatus comprising, in some embodiments, a plurality of immiscible fluids. The boundary between the fluids is made substantially planar with the application of select voltages to electrodes distributed around the cell containing the fluids. The electrodes are also adapted to alter the orientation of the substantially-planar fluid boundary, thereby allowing the fluid boundary to be steered in a determined direction. Light impinging on the boundary may therefore be refracted and redirected in a determined direction. Similarly, a reflective surface may be held in suspension at the fluid boundary, thereby providing a mirror with which to redirect impinging light. The electrowetting cell disclosed herein may be used as an optical switch, actuator, lens, concentrator, or like device.
US07864434B2

In a particular embodiment, a solid immersion lens includes meta-material slabs formed from multiple layers of at least two different compositions. Each meta-material slab has a first effective index of refraction. The meta-material slabs are adapted to propagate an evanescent wave in a direction parallel to an axis to form a cone-shaped wave along the axis. The solid immersion lens further includes a core sandwiched between the meta-material slabs along the axis and having a second index of refraction that is less than the first effective index of refraction. The core directs surface plasmons that are excited by the cone-shaped wave to a focused area coincident with the axis.
US07864433B1

An exemplary optical hybrid includes a 50/50 un-polarized beam splitter, a folding prism, a beam shifter, a spacer and a phase shifter such that from an input S-beam (signal) and an L-beam (reference), four outputs, S+L, S−L, S+jL and S−jL, are produced. The phase difference between the two components of each output beam produced by the S and L beams in the optical hybrid is θ+0, θ+90, θ+180, or θ+270 degrees, where θ is the phase difference of the signal beam with respect to the reference beam. In an alternative embodiment, the phase difference between the two components of each output beam produced by the S and L beams in the optical hybrid is θ+0, θ+X, θ+180, or θ+180+X degrees, where X is an arbitrary number of degrees greater than 0 and smaller than 180.
US07864432B2

A fusion night vision system having image intensification and thermal imaging capabilities includes an edge detection filter circuit to aid in acquiring and identifying targets. An outline of the thermal image is generated and combined with the image intensification image without obscuration of the image intensification image. The fusion night vision system may also include a parallax compensation circuit to overcome parallax problems as a result of the image intensification channel being spaced from the thermal channel. The fusion night vision system may also include a control circuit configured to maintain a perceived brightness through an eyepiece over a mix of image intensification information and thermal information. The fusion night vision system may incorporate a targeting mode that allows an operator to acquire a target without having the scene saturated by a laser pointer. The night vision system may also include a detector, an image combiner for forming a fused image from the detector and a display, and a camera aligned with image combiner for recording scene information processed by the first detector.
US07864431B2

Certain example embodiments relate to a head-up display system for a vehicle having a windshield. First and second substantially parallel spaced-apart substrates sandwich a polymer-inclusive interlayer. An anti-reflective coating is provided on a surface of one of the first and second substrates. The anti-reflective coating is arranged so as to optically remove or block at least some of light rays produced by an image source of the head-up display system so as to reduce the occurrence of multiple images being produced by the image source. The anti-reflective coating is provided on a surface of the first or second substrate opposite the polymer-inclusive interlayer. In certain example embodiments, the polymer-inclusive interlayer may include polyvinyl butyral and/or may have a substantially uniform thickness.
US07864430B2

In an optical etalon with a fixed FSR determined by the cavity length, the time delay is adjusted by an etalon surface coating. The proper cavity length is chosen to achieve a desired FSR, and the coating is independently selected to obtain a desired time delay.
US07864428B2

An optical recognition device is provided. The optical recognition device includes a transparent substrate, a patterned infrared reflective film formed thereon, and an infrared anti-reflective film sheltering a gap in a recognition pattern of the patterned infrared reflective film, wherein the patterned infrared reflective film reflects the recognition pattern by reflection of infrared light and transmission of visible light. The invention also provides a display incorporating the optical recognition device.
US07864426B2

A method to stabilize planar nanostructures, for example grating and zone plate lenses that are typically used for directing or focusing x-ray radiation, includes the deposition of a top, stabilizing layer. The structures are typically made on a flat substrate, and therefore are only fixed at the bottom. At high aspect ratio, the stability can be poor since small forces such as electrostatic forces and van de Waals forces that are often present can alter the structure. The top coating of a metallic material such as titanium constrains the nanostructures at the top and at the same time eliminates electrostatic forces and reduces any thermal gradient that may be present across the device.
US07864423B2

Spectrally filtering at least one input beam includes: dispersing spectral components of at least one input beam at respective angles in a spectral plane; changing at least some of the angles of the propagation axes of the dispersed spectral components so that a plurality of the spectral components reflect from a single reflective surface; and tilting the reflective surface to select at least one and fewer than all of the received spectral components to be directed to an output spatial mode.
US07864422B2

A display device comprising: a display cell including at least two color regions, each of the at least color regions including a right-eye pixel and a left-eye pixel corresponding to a right eye and a left eye of a viewer, respectively; and a lenticular cell including at least two lenses corresponding to the at least two color regions, wherein the at least two lenses having different focal lengths.
US07864417B2

A telescope having a focus display includes a tube assembly, a sensor and a focus display. The tube assembly has a first tube and a second tube connected within the first tube. The first tube has an opening. The sensor is provided on the second tube. The focus display is provided in the opening of the first tube. The focus display is provided with a screen, a processing unit and an electromagnetic sensing unit. The electromagnetic sensing unit, the processing unit and the screen are electrically connected with each other. When the first tube is telescopically moved with respect to the second tube, the electromagnetic sensing unit receives and senses the change in the electromagnetic field of the sensor. The processing unit then calculates the displacement and displays the data on the screen, so that the user can focus the telescope to obtain the clearest image.
US07864407B2

A display element which has an electrolyte layer containing silver or a compound containing silver in the chemical structure thereof and an electrolytic solvent between opposed electrodes, and also contains a porous white scattering material between said opposed electrodes, wherein said opposed electrodes can be operated so as to dissolve silver or deposit silver, characterized in that said porous white scattering material is incorporated through a step of imparting an aqueous intimate mixture containing a water-soluble polymer substantially insoluble in said electrolytic solvent and a white pigment onto a component between said opposed electrodes, followed by drying. The above display element is composed of simple and easily available members, can be operated with a low voltage, exhibits high display contrast and satisfactorily high reflectance for the white display, and is reduced in the fluctuation of the white reflectance.
US07864404B2

A light guide unit includes a light guide plate and a plurality of light-exiting protrusions. The light guide plate includes a light-entering surface, an upper surface connected to the light-entering surface and a lower surface facing the upper surface. The light-exiting protrusions protrude from the upper surface of the light guide plate to have a cylindrical shape in which a cross-section size thereof increases in a direction away from the upper surface of the light guide plate, the light-exiting protrusions being disposed in a light control area which is turned on or off by a microelectromechanical system shutter. Light guided by the light guide unit to the light control area exits through the light-exiting protrusions.
US07864398B2

A method for manufacturing an electrochromic element comprises providing a first substrate having first and second surfaces opposite one another and a first edge surface, providing a second substrate having third and fourth surfaces opposite one another and a second edge surface, wherein the third surfaces faces the second surface, and providing an electrochromic medium located between the first and second substrates, wherein the electrochromic medium has a light transmittance that is variable upon the application of electric field thereto. The method further complies applying a conductive layer on at least a portion of at least a select one of a first, second, third, and fourth surfaces and the first and second edge surfaces, wherein applying the conductive layer is accomplished at substantially atmospheric pressure and including applying at least a select one of metallic particles, an organometallic, a metallo-organic, and combinations thereof, and wherein the conductive layer has a bulk resistivity of less than or equal to 150 μΩ·cm. Other aspects of this invention comprise applying the conductive layer via ink jetting, ultrasonic spraying, auger pumping and jet pumping.
US07864394B1

A dynamically variable lens is made from actively tunable electromagnetic metamaterial cells. The lens operates on electromagnetic radiation including: radio frequency waves, microwaves, teraherz waves, near infrared waves, infrared waves and visible waves. The focal length of the lens is changed at a selected frequency. In the alternative, the frequency of radiation operated on is changed as a function of time. A third alternative provides precise control of the index of refraction of the lens. The index of refraction is varied progressively across the lens from one edge to the opposite edge causing the radiation to be directed at an angle.
US07864369B2

An imaging apparatus consists of multiple miniaturized microscopes arranged into an array capable of simultaneously imaging respective portions of an object. A continuous linear translation approach is followed to scan the object and generate multiple image swaths of the object. In order to improve the quality of the composite image produced by concatenation of the image swaths, the performance of each microscope is normalized to the same base reference for each relevant optical-system property. Correction factors are developed through calibration to equalize the spectral response measured at each detector, to similarly balance the gains and offsets of the detector/light-source combinations associated with the various objectives, to correct for geometric misalignments between microscopes, and to correct optical and chromatic aberrations in each objective.
US07864368B2

An image forming apparatus of the invention includes a read unit to read an original document, a storage unit to store an image file of the original document read by the read unit, a control unit to control storage and readout of the image file into and from the storage unit, and an image formation unit to print the image file read from the storage unit, and the control unit creates a template including one or plural elements, automatically creates an image file name based on the template when the image file is stored in the storage unit, and stores the image file. According to the image forming apparatus of the invention, when a file is stored, an operation burden is low and an easily identified file name can be created.
US07864364B2

A color transformation method which accounts for colorant interactions includes establishing a plurality of tone reproduction curves (TRCs), for one or more of the color separations forming a digital image. Each TRC accounts for colorant interactions between a primary colorant with which the first color separation is to be rendered and at least one secondary colorant with which at least a second of the plurality of color separations is to be rendered. The TRCs include input values and their corresponding modified input values. In a given TRC, the input values of the second and optionally other color separations are fixed. For a pixel of the digital image having a given input values for the first and second color separation one or more of the TRCs are selected which bound the fixed input value for the second color separation and a modified input value is determined therefrom.
US07864361B2

An inkjet printer including a body housing a print engine configured to transport and print upon print media. The print engine includes a memory buffer of sufficient size to enable printing of one compressed page whilst receiving another compressed page. Each compressed page includes compressed contone data and compressed bi-level data. The print engine is configured to expand each compressed page during printing. A retractable cover is pivotally mounted relative to the body and is able to be pivoted to form a guide which can guide print media to the print engine for printing.
US07864354B2

A system and method for controlled monitoring of pending document processing operations is provided. Each document processing request received by a document processing device is assigned a job name, which is then encrypted using a random static encryption key, resulting in a job identification. A user then logs onto the document processing device to view pending jobs, which are displayed to the user by only job identification. Those jobs with which the user is associated are then decrypted by the document processing device, allowing the user to view job information including status and file name. The user is thereby also able to modify or delete those pending jobs with which the user is associated. Once the job queue is empty, the random static encryption key is deleted and a new key is generated when a document processing request is received into the empty queue.
US07864352B2

A printer with an embedded multimedia server is described that includes a processor primarily allocated for print control and another processor for executing a multimedia server for interfacing with hardware and/or software interfaces for various forms of media. Examples of such interfaces include, a network interface, a VGA port, transcoding hardware, wireless interfaces and a (USB) port. Examples of types of media processed include video, audio and text. The multimedia server performs multimedia content processing, particularly for time-based data, examples of which include editing, formatting, scheduling capture of content, searching, recognition, and event detection. Additionally, the printer can provide a multimedia storage database. The printer provides a user interface on its chassis that can provide a web browser, so that a user can interact directly with the printer for indicating preferences for multimedia content processing and/or selection for printing onto a desired output medium.
US07864345B2

A printer is disclosed. The printer includes a print media supply station for storing print media. The printer further includes a print engine station arranged to receive print media from the print media supply and to print on the print media. A binding assembly station is also included which is configured to apply adhesive along an edge of each sheet of print media after printed upon, and to compile the print media into a bound stack. A receptacle station receives the bound stack. The print media supply station, the print engine station, the binding assembly station and the receptacle station are arranged vertically.
US07864340B2

The method comprises positioning a diffraction grating with a two-dimensional meshing on the path of the beam to be analyzed and processing at least two interferograms of at least two different colors, each interferogram being obtained in a plane from two sub-beams with different diffraction orders. The invention can be used to analyze and correct divided wavefronts.
US07864339B2

To measure a hollow three-dimensional object without contact, this object being translucent or transparent vis-á-vis a visible light, an image of the object is acquired by single-view backlit shadowgraphy, along a viewing axis, by observing this object with visible light, this image comprising at least one luminous line, an equation is established that connects at least one optogeometric parameter of the object to at least one geometric parameter of the luminous line, this geometric parameter is determined, and the optogeometric parameter is determined by means of the equation and the geometric parameter thus determined.
US07864334B2

Methods and systems for using common-path interferometry are described. In some embodiments, a common-path interferometry system for the detection of defects in a sample is described. An illumination source generates and directs coherent light toward the sample. An optical imaging system collects light reflected from the sample including a scattered component of that is predominantly scattered by the sample, and a specular component that is predominantly undiffracted by the sample. A variable phase controlling system is used to adjust the relative phase of the scattered component and the specular component so as to improve the ability to detect defects in the sample.
US07864333B1

A system for detecting piston diversity between mirror segments. The system includes a pupil plane mask, a transform optical element, and an image detector. The pupil plane mask includes two or more open mask areas and two or more polarizers. Each polarizer is disposed within a respective one of the open mask areas. A first one of the two or more polarizers has a first polarization orientation, and a second of the two or more polarizers has a second polarization orientation.
US07864325B2

An interferometer of the invention includes: a first splitting element which includes a first transparent medium and a first splitting film formed on the first transparent medium, and which splits incident light into a first split beam and a second split beam, the first split beam being the incident light reflected by the first splitting element and the second split beam being the incident light transmitted through the first splitting element; and a second splitting element which includes a second transparent medium and a second splitting film formed on the second transparent medium, and which causes interference between the first split beam and the second split beam passed through different optical paths, the second splitting element being positioned such that a positional relationship between the second transparent medium and the second splitting film with respect to a direction of incidence on the second splitting element of the first split beam is opposite to a positional relationship between the first transparent medium and the first splitting film with respect to a direction of incidence of the incident light on the first splitting element.
US07864321B2

There is provided an evanescent wave multimode optical waveguide sensitive to a chemical species or to a physical parameter. The optical waveguide comprises a core and a cladding having a cladding refractive index lower than that of the core for guiding light to be propagated in the optical waveguide. The cladding defines with the core an optical waveguide providing mode coupling. A chemical indicator is provided in the cladding for causing a variation of the optical absorption of the cladding as a function of the chemical species or the physical parameter. The cladding is interrogated by the evanescent wave of the propagated light. The mode coupling causes unabsorbed light power to be redistributed among the multiple modes while light propagates along the optical waveguide.
US07864320B2

A method for estimating color measurements of color samples includes printing a color sample based on input data, measuring a color of the printed color sample with an in-line spectral sensor at a first temperature, and estimating a color of the printed color sample which would be output by a reference spectral sensor at a second temperature. The estimation is based on a thermochromatic model which represents relationships between measured colors of printed color samples on the in-line spectral sensor at the first temperature and the reference spectral sensor at the second temperature. The reference spectral sensor is a different type of sensor from the in-line spectral sensor, so the color response of the two spectral sensors is different, even when the measurement conditions are identical. Consequently, a set of printed spot color samples generate different measured colors at the second temperature on the in-line spectral sensor from the reference spectral sensor. The exemplary method allows these differences, as well as measurement temperature differences to be accounted for in the estimation.
US07864316B2

In one general aspect, a spectroscopic method for monitoring heterogeneity of a sample is disclosed. In this method, sampled spectroscopic measurements are acquired over a range of different micro locations in a macro-sample of the sample. This step is repeated for micro-locations in further macro-samples of the sample, and a statistical measure of chemical heterogeneity is derived from the acquisitions. In another general aspect, differently sized samples are acquired, and a statistical measure of chemical heterogeneity is derived from these acquisitions.
US07864311B2

The invention relates to a method and a device for producing and detecting a Raman spectrum. The problem addressed by the present invention is that of devising a method and a device for producing and detecting a Raman spectrum of a medium under investigation, whereby the Raman spectrum of a medium that is under investigation can be examined with a high degree of sensitivity while requiring relatively little equipment. The method is characterized by the coupling of excitation radiation into a medium (8) under investigation and the coupling of the electromagnetic radiation scattered by the medium (8) under investigation into a spectral optic system (10), a laser diode (1) for generating excitation radiation with at least two different wavelengths (λ1, λ2) being controlled with at least two different excitation conditions and at least one Raman spectrum (16, 17) being detected in each case from the scattered radiation at the different excitation wavelengths (λ1, λ2), and the Raman spectrum (20) of the medium (8) under investigation being determined from the at least two detected Raman spectra (16, 17), the two different excitation conditions for the laser diode (1) being adjusted by means of the electric current supplied to the laser diode (1).
US07864310B2

When measuring an edge region, a photo detector with an angle not influenced by the diffracted light, the diffracted light causing noise, is selected to thereby allow for inspection that minimizes the sensitivity reduction. This allows for the management of foreign matters in the outer peripheral portion, which conventionally could not be measured, and this also eliminates the oversight of critical defects on the wafer, thus leading to reduction of failures of IC.
US07864308B2

This invention discloses a position detection method for detecting the focus position of an optical position detection apparatus including an image sensor and an optical system which forms an image of a target object on the image sensing surface of the image sensor. In this method, the relationship between the position of the target object in the optical-axis direction of the optical system and the evaluation value of the signal output from the image sensor is measured, and the position of a peak close to a reference focus position, which is selected if the evaluation value has a plurality of peaks in the measured relationship, is detected as the focus position.
US07864306B2

A personal identification system, which uses a vein pattern of a finger, optimizes the amount of light of a light source based on a captured finger image and emphasizes the vein pattern during image processing for identification.
US07864291B2

An exposure apparatus, which has a projection optical system configured to project a pattern of a reticle onto a substrate, and exposes the substrate to light via the reticle and the projection optical system, with a space between the projection optical system and the substrate filled with liquid. A supply nozzle supplies liquid to the space, a supply path supplies the liquid to the supply nozzle, a bypass branches from the supply path, and a supply control valve changes a flow rate of the liquid supplied from the supply path to the supply nozzle to control the supply of the liquid to the space, and a liquid quality sensor arranged in the bypass measures a purity of the liquid. The supply of the liquid to the space is controlled based on a measurement performed by the liquid quality sensor, so that liquid having a purity satisfying a standard is supplied to the space.
US07864290B2

A system and method for coding an intermediate film element, e.g., an interpositive or an internegative, in an effective manner while maintaining the integrity of the film element. A first coat of a stabilizer is applied to frames of a selected scene. A second coat of stabilizer is applied, and a third coat of stabilizer is thereafter applied. A security code according to the present invention may be applied to specifically selected locations on a reel or footage so as to create a unique code which is traceable to, e.g., a specific laboratory.
US07864283B2

A liquid crystal display is provided with a control pattern to allow liquid crystal and a sealing agent to desirably flow during a liquid crystal injection process. The liquid crystal display includes an insulating substrate, a plurality of thin film transistors formed on the insulating substrate, a liquid crystal injection opening formed in a portion outside a region where the plurality of thin film transistors is formed, a first display panel including a plurality of control patterns formed in the liquid crystal injection opening, and a second display panel disposed to face the first display panel.
US07864271B2

A display device in which an image with a wide color reproduction range and bright red can be displayed is provided. The display device is a display device such as, for example, a liquid crystal display device, a cathode ray tube, an organic electroluminescent display device, a plasma display panel, and a field emission display. The display device includes a display surface including a pixel having red, green, blue, and yellow sub-pixels, wherein the red sub-pixel preferably has the largest aperture area.
US07864270B2

An electronic device (200) includes a display (202) and an LC shutter (204), at least a portion of which is operatively positioned over the display (202). The LC shutter (204) provides switching between a transparent state and a diffusive state with high image integrity, and high transmission in the transparent state. In one embodiment, the electronic device (200) further includes control logic (206) operatively coupled to the LC shutter (204) to provide control signals (212) to the LC shutter (204) to effect the transparent state. The LC shutter (204) includes a first dichroic polarizer (300), such as a broadband dichroic polarizer, an LC cell (304), and a diffusive reflective polarizer (307). The LC cell (304) is interposed between the first dichroic polarizer (300) and the diffusive reflective polarizer (307). Related methods are also set forth.
US07864268B2

An object of the invention is to provide a display device having a high contrast ratio. Another object of the invention is to manufacture such a high-performance display device at low cost. In a display device having a display element between a pair of light-transmissive substrates, polarizer-including layers, which have different wavelength distributions of extinction coefficients, are stacked so that absorption axes are in a parallel nicol state, over each light-transmissive substrate. Absorption axes of one of a pair of stacks of polarizers and the other together which interpose the display element are deviated from a cross nicol state. A retardation plate may be provided between the stack of polarizing plates and the substrate.
US07864265B2

In a lamp holder for holding an end section of a fluorescent lamp, a long groove is formed on a plane facing a light entrance plane of a light guide plate, in a same direction as the longitudinal direction of the light entrance plane, and a first hole is formed on a plane vertical to the light entrance plane, at a position below the bottom surface of the long groove, for inserting the end section of the fluorescent lamp.
US07864261B2

A backlight module includes a rear plate, at least one light source disposed on the rear plate, at least two support elements respectively disposed on two opposite sides of the rear plate, and at least one optical film disposed above the light source. The optical film includes at least two fixing holes respectively corresponding to the support elements. The support elements respectively engage with the fixing holes to tension the optical film with at least one pair of tensile forces oriented in opposite directions.
US07864253B2

An image display includes the following components. A display panel has a plurality of pixels arrayed in a first direction and a second direction intersecting the first direction. A light source emits light toward the display panel. A polarization-axis control unit separates the light emitted from the light source into light having a first polarization axis and light having a second polarization axis. An optical element allows the light emitted from the light source to travel in a direction substantially orthogonal to the first direction. The polarization-axis control unit includes a first substrate, a second substrate, a liquid crystal layer sandwiched between the first and second substrates, a first electrode, a second electrode, and a third electrode. The third electrode is superposed over the first electrode and the second electrode in a region corresponding to a pixel array area of the display panel.
US07864252B2

A video signal processor for processing input video data in accordance with an input clock signal includes: an input section for changing the format of the video data and outputting resultant data; a logic section for decoding the data output from the input section and outputting decoded data; and a frequency detector for detecting that the clock signal has a frequency higher than a given frequency and outputting a result of the detection as a detection signal. When the frequency of the clock signal is higher than the given frequency, operation of at least part of circuits constituting the video signal processor is stopped in accordance with the detection signal.
US07864246B2

Presented herein are system(s), and method(s), for interlaced to progressive conversion using weighted average of spatial interpolation and weaving. In one embodiment, there is presented a deinterlacer for deinterlacing. The deinterlacer comprises a first circuit and a second circuit. The first circuit measures weave artifacts between an alternate field and a field for a pixel at a pixel position in the alternate field. The second circuit generates a pixel value for the pixel position in the field, where the pixel value is the weighted average of the pixel, and an interpolated value from two or more pixels from the field, where the weighted average is a function of the weave artifacts.
US07864238B2

A solid-state imaging device includes an imaging region having a plurality of pixels arranged. Each of the pixels includes a photoelectric converting portion and a charge converting portion for converting a charge generated by photoelectric conversion into a pixel signal. Further each pixel includes a first gate portion for charge accumulation and a second gate portion for charge readout that are formed between the photoelectric converting portion and a floating diffusion portion.
US07864229B2

An image pick-up device includes a first correlated double sampling circuit configured to generate a first sampling signal by performing correlated double sampling on an active pixel signal output from an active pixel and generating a first comparison signal by comparing the first sampling signal with a reference signal, and a second correlated double sampling circuit to generate a second sampling signal by performing correlated double sampling on an OB pixel signal output from an optical black pixel and generating a second comparison signal by comparing the second sampling signal with the reference signal.
US07864228B2

An object area in an image is determined, and an area image representing the object area is superimposed on the object in the image. In this image, an area to be photographed with high quality is specified using the area image, and a control parameter for controlling an image pickup unit is adjusted so that the quality level of an image within the area to be photographed with high quality is increased to a desired level. Thus, when photographing an image, an area to be photographed with high quality can be easily set in the image.
US07864223B2

A video signal processing circuit converting a color image represented using a plurality of primary color signals into a monocolor image is provided. The video signal processing circuit includes: a chroma adjustment unit adjusting the chroma of the plurality of input primary color signals; a gain correction unit provided for each of the primary color signals, correcting gain on the primary color signals whose chroma is adjusted in the chroma adjustment unit; and a control unit instructing the chroma adjustment unit to adjust the chroma and instructing each of the gain correction units to correct the gain.
US07864219B2

An input video signal is encoded at a plurality of coding layers exhibiting different spatial resolutions. The input video signal is spatially scaled down to a resolution-lowered video signal that exhibits a resolution lower than the video signal. The resolution-lowered video signal is encoded by using a quantization parameter, with a decoding procedure, thus obtaining first coded data and a decoded signal. The decoded signal is spatially scaled up through a high-resolution procedure for controlling high-frequency components estimation depending on the quantization parameter, thus obtaining a high-resolution scaled-up video signal. The input video signal is encoded through inter-spatial resolution prediction using the high-resolution scaled-up video signal as a predictive signal, thus obtaining second coded data that exhibits a resolution higher than the resolution-lowered video signal.
US07864214B2

A signal processing device includes a system of circuit processing in essence while avoiding large sized device under restoring fluctuated signals such as deterioration and the like. The signal processing unit includes a processing unit that restores one of a signal before fluctuation, a signal which should have been intrinsically obtained, and signal data which is approximated from these signals from an initial signal which has fluctuated like deterioration. A fluctuated data region storing fluctuated data and a restored data region storing signal data (restored data) restored every restoring process are installed. The processing unit repeats the following processes in order to produce data formed in the restored data region at the completion of processing as original signal data. The processing unit transfers energy of the fluctuated data from the fluctuated data region to the restored data region using fluctuation-factor information data, which is a fluctuation factor, and produces restored data; and substitutes residual data in the fluctuated data region remained through the data transfer for the fluctuated data.
US07864210B2

A system for generating video images and corresponding audio of multiple parties engaged in a video conference is provided. The system includes multiple voice transducers for receiving voice signals from the multiple parties and a video camera for capturing moving images of one of the multiple parties who is speaking. The system further includes a processor in communication with the voice transducers and video camera. The processor determines respective distances and angles between the party who is speaking and each of the multiple voice transducers. Additionally, the processor identifies a location of the party who is speaking relative to the video camera based on the determined respective distances and angles. Based on the identified location, the processor selects a portion of a video frame produced by video camera and processes the selected portion to mitigate optical distortion and generate an overall picture in which the party speaking does not appear unnaturally small relative to the overall picture.
US07864205B2

A heat-sensitive transfer image forming method, containing: superposing receptor layer side of image-receiving sheet and dye layer side of ink sheet, making a thermal head contact with the sheets from lubricating layer side of ink sheet, and applying heat while making the head and ink sheet move at 60 mm/s or more relatively, and thereby transferring dye to form an image; wherein image-receiving sheet has heat insulation layer containing hollow polymer particles, receptor layer and/or heat insulation layer contains a water-soluble polymer; lubricating layer contains inorganic particles in 0.01-5 mass % to the total solid content of lubricating layer, the particles have Mohs' hardness 3-6 and mean particle size 0.3-5 μm, and the ratio of the maximum width of each particles to the sphere equivalent diameter thereof is 1.5-50; and when 0.7 J/cm2 energy is applied, contact distance between the head and lubricating layer is 350-450 μm.
US07864200B1

Systems and apparatus, including computer program products, implementing techniques for compositing a digital image. The invention performs the steps of identifying a graphics element in a compositing order, the graphics element identifying a source image from among a plurality of images; copying the source image into a working buffer; using the element to modify the working buffer by applying a general filtering operation to data in the working buffer; and crossfading a first image with the modified working buffer.
US07864192B2

A dithering system includes a linear transformer, a dither data generator, an adder and a shifter. The transformer linearly transforms M bit input data using a linear function having a predetermined gradient in order to generate and output M bit transform data. The dither data generator generates and outputs M−N bit dither data. The adder adds the M bit transform data and the M−N bit dither data to generate and output M bit correction data. The shifter cuts off the bottom M−N bits of the M bit correction data in order to generate and output the N bit output data. The dithering system and associated dithering method widely disperses an error generated due to a physical limit of a data bit that can be expressed by a low gray scale system throughout the entirety of the gray scales when high gray scale image data is converted to low gray scale image data. This is done without using a lookup table which avoids using valuable chip area. In addition, by utilizing a plurality of adders and shifters rather than a multiplier and divider, the number of required logic gates is remarkably reduced as well as reducing associated power requirements.
US07864189B2

In one embodiment, the present invention includes a method to convert a pixel tuple in a red, green, blue (RGB) color space having R, G, and B color values into a human recognizable color name corresponding to a range of numerical values of a linear color palette scale based on application of the RGB color values to a predetermined set of hierarchical rules. Other embodiments are described and claimed.
US07864186B2

Embodiments relate to display of visual content on a client device using server-side rasterization of visual content. According to some embodiments, visual content is rendered on a server system, transformed into bitmaps compatible with the display attributes of a client device, and transmitted for display on the client device. The server system can perform, in effect, as a remote browser for displaying Web pages, e-mail, e-mail attachments, electronic document and forms, database queries and results, drawings, presentations, images at the client device, and so on. The approach can be “remote” because the server does the rendering and the client provides the interface; “multi-level” because rendered visual content is represented as a multi-level set of raster representations; and constitutes a “browsing system” because the client and server share data about the source visual content element being browsed, and the client performs a specific browsing function assisted by the server.
US07864173B2

A user of a modeling application modifies an initial virtual object using a sketch drawn on one or more construction planes. Typically, construction planes are connected by an axis that intersects the virtual object. The user can draw a sketch on each construction plane, and the modeling application interpolates a shape along the axis between the sketches to determine what material in the virtual object is to be removed from it. In this manner, material may be removed to create a recess or hole in the virtual object or otherwise to slice away material from the object. A user can use two or more axes and construction planes to produce complex shapes from the initial virtual object. A user can also select a portion of a virtual object and mirror the selected portion. Modifications that the user makes in the selected portion are made correspondingly in the mirrored portion.
US07864171B2

An organic EL display apparatus includes: a display panel on which a plurality of pixel sections are provided; source drivers provided with pixel drivers, which includes current drivers for supplying drive currents to the pixel sections, registers for latching data signals and timing control units; signal lines for supplying the drive currents from the current drivers to the pixel sections. Each of the current drivers is controlled by the associated timing control unit to allow a current larger than or equal to a current which is set in accordance with the data signal to flow only during a given period in a current setting mode, so that the value of a current flowing in the pixel section reaches a target value in a short time.
US07864167B2

A display device that displays image information in response to a digital display signal includes a display panel signal lines and scanning lines which intersect at right angles with each other, and a plurality of display pixels with optical elements arranged near the intersecting points of the signal lines and scanning lines. A signal driver circuit has a plurality of current generation circuits including a drive current generation circuit for generating drive current from a plurality of gradation currents based on the display signal value supplied to each of the scanning lines, a scanning driver circuit for sequentially applying a scanning signal to each of the scanning lines for setting the selection state of each line of each display pixel, and a gradation current generation circuit for generating gradation currents according to each display signal bit at least based on a constant predetermined reference current.
US07864155B2

A display control circuit includes a vertical timing control circuit that generates first and second start signals, a panel driving unit that sequentially drives a plurality of OCB liquid crystal pixels in units of one row under the control of the first start signal to hold pixel voltages for gradation display in the pixels PX of the driven row, and that sequentially drives the pixels in units of at least one row under the control of the second start signal to hold pixel voltages for black insertion in the pixels of the driven row, and a light source driving unit that drives a plurality of backlight sources arranged substantially in parallel to the rows of pixels. In particular, the light source driving unit is configured to start, in synchronism with the first start signal, an operation for sequentially blinking the backlight sources with a predetermined duty ratio. The predetermined duty ratio is determined in accordance with a dimmer signal from outside such that the predetermined duty ratio, at a maximum value thereof, is not greater than a ratio of a holding period of the pixel voltage for gradation display to a sum of the holding period of the pixel voltage for gradation display and a holding period of the pixel voltage for black insertion.
US07864152B2

Disclosed are a liquid crystal display, which can increase a design margin upon designing a driving timing chart, improve picture quality characteristics and reduce power consumption, and a method for driving the same. The liquid crystal display of a field sequential color type comprises an LCD panel having a plurality of pixels arranged in a matrix form defined by gate lines and data lines crossing each other, a sub-field time setting unit for selecting 1 horizontal period according to an externally input frame frequency and a first user-set signal and determining a wait period and a flash period corresponding to the 1 horizontal period according to second and third user-set signals, a timing controller for producing and outputting a gate control signal and a data control signal corresponding to the 1 horizontal period and the wait period and a light source control signal corresponding to the wait period and a re-aligned pixel data, a gate driver for sequentially outputting a scan pulse to the gate lines according to the gate control signal, a data driver for outputting a data voltage to the data lines every 1 horizontal period according to the data control signal, and a backlight unit for sequentially outputting red, green and blue light to the pixels, respectively, according to the control of the timing controller.
US07864151B1

A thin, readily portable book has a memory-type liquid crystal display in the display section of the thin portable book so as to obtain low power consumption along with compact size and reduced weight, a solar cell and a charging device in the energy section of the thin portable book, so that low power consumption is further promoted, a freely detachable cassette-type or card-type non-volatile semiconductor memory in the recording medium section of the thin portable book so as to provide further savings in power consumption.
US07864147B2

A potential supplied from a capacitive load drive unit to one end of a respective capacitive load is switched to an intermediate potential between a first and a second power supply potentials for a predetermined period of time prior to switching the potential of the one end of the capacitive load from the first to the second power supply potential, or vice versa, which minimizes charging and discharging currents of the load, variations of the potential supplied to the capacitive load, and hence power consumption involved, without providing a charging capacitor having a large capacitance in the capacitive load drive unit.
US07864146B2

An exemplary gamma voltage output circuit (2) for a liquid crystal display includes a plurality of operational amplifiers (221) and a plurality of resistors (Rn1˜Rn2). Each of the operational amplifiers includes a high voltage input port, a low voltage input port, a non-inverting input port, an inverting input port, and an output port. The high voltage input port of each operational amplifier connects to a same electrical source, and the low voltage input port of each operational amplifier is grounded. The non-inverting input port of each operational amplifier receives a same direct-current voltage, and the output port of each operational amplifier outputs a gamma voltage configured for driving the liquid crystal display and is grounded via two respective of the resistors connected in series. A node between the two respective resistors connects to the inverting input port of the operational amplifier.
US07864143B2

This invention provides a display device in which it is possible to have a light emitting element emitted light with constant luminance without coming under the influence of deterioration over time, and it is possible to realize accurate gray scale express, and yet, it is possible to speed up writing of a signal current to each pixel, and influence of noise of a leak current etc. is suppressed, and a driving method thereof. A plurality of pairs of switch portions and current source circuits are disposed in each pixel. Switching of each of a plurality of the switch portions is controlled by a digital video signal. When the switch portion is turned on, by a current supplied from the current source circuit making a pair with the switch portion, the light emitting element emits light. A current which is supplied from one current source circuit to the light emitting element is constant. A value of a current flowing through the light emitting element is comparable to a value of added currents which are supplied to the light emitting element from respective all current source circuits making pairs with the switch portions which are in the conductive states.
US07864139B2

An organic electroluminescent device including: a plurality of pixels, each having a red light emitting element to emit red light, a green light emitting element to emit green light, and a blue light emitting element to emit blue light; and a drive device adjusting a luminance ratio among the red light, the green light, and the blue light by adjusting light emitting time of each of the red light emitting element, the green light emitting element, and the blue light emitting element.
US07864127B2

The discone antenna is a small communication antenna with broad voltage standing wave ratio (VSWR) bandwidth. The discone antenna includes a conical antenna element and a disc antenna element adjacent the apex thereof and including a proximal electrically conductive planar member and a spaced apart distal electrically conductive planar member being electrically connected together at respective peripheries thereof defining a folded ground plane. An antenna feed structure is coupled to the disc and conical antenna elements and includes a first conductor coupled to the proximal electrically conductive planar member, and a second conductor coupled to the conical antenna element and to the distal electrically conductive planar member. An impedance element, such as a resistor, may be connected between the second conductor and the distal electrically conductive planar member.
US07864123B2

Handheld electronic devices are provided that contain wireless communications circuitry. The wireless communications circuitry may include an antenna. The antenna may be formed from a ground plane having a dielectric-filled slot that defines a slot antenna structure and having a planar-inverted-F (PIFA) resonating element located above the opening. The slot antenna structure and the PIFA resonating element may both contribute to the performance of the antenna, so that the antenna exhibits the performance of a hybrid PIFA-slot antenna. The PIFA resonating element may contain multiple antenna resonating element branches. The branches may be configured to operate in different communications bands than the slot antenna structure.
US07864119B2

A circuit board for wireless communications includes communication circuitry for modulating and/or demodulating a radio frequency (RF) signal and an antenna apparatus for transmitting and receiving the RF signal, the antenna apparatus having selectable antenna elements located near one or more peripheries of the circuit board. A first antenna element produces a first directional radiation pattern; a second antenna element produces a second directional radiation pattern offset from the first radiation pattern. The antenna elements may include one or more reflectors configured to provide gain and broaden the frequency response of the antenna element. A switching network couples one or more of the selectable elements to the communication circuitry and provides impedance matching regardless of which or how many of the antenna elements are selected. Selecting different combinations of antenna elements results in a configurable radiation pattern; alternatively, selecting several elements may result in an omnidirectional radiation pattern.
US07864114B2

Each of unit cells constituting a negative permeability medium includes a metal patch formed on a surface of a dielectric substrate. The dielectric substrate has a rear surface having a ground conductor formed on its entire surface. A positive permeability medium is an existing micro strip line and each of unit cells has a two-dimensional structure having a metal strip connected in four directions. The dielectric substrate has a rear surface having a ground conductor formed on its entire surface. The negative permeability medium is arranged at the left side adjacent to the positive permeability medium formed by unit cells arranged at the right side so that the media oppose to each other. A waveguide formed by the positive/negative permittivity medium or the positive/negative permeability medium of the meta material for propagation of a surface wave is formed at the boundary of the two media.
US07864106B2

A method and system for SNR enhancement in pulse-Doppler coherent target detection for applications in the fields of radar and ultrasound. In accordance with the method of the invention, complex signals are obtained for each of two or more sub-intervals of the time-on-target interval, allowing simultaneous range and Doppler measurements. A coherent integration is the performed on the signals to generate complex-valued folded matrices. The folded matrices are unfolded and target detection is then performed in a process involving one or more of the unfolded matrices. A pulse-Doppler coherent system is also provided configured for target detection by the method of the invention.
US07864099B2

A low cost radar system that employs monopulse beamforming to detect objects in the road-way both in elevation and azimuth. In one non-limiting embodiment, a beamforming receiver architecture includes a first beamforming device and a plurality of antennas coupled to the first beamforming device, and a second beamforming device and a plurality of antennas coupled to the second beamforming device. The first and second beamforming devices are oriented 90° relative to each other so that the receive beams provided by the first beamforming device detect objects in azimuth and the receive beams provided by the second beamforming device detect objects in elevation. A first switch is provided to selectively couple the sum pattern signal from the first and second beamforming devices to one output line, and a second switch is provided to selectively couple the difference pattern signals from the first and second beamforming devices to another output line.
US07864095B2

The problem of the present invention is to offer a wave absorber that has reflection attenuation capability sufficient to enable prevention of communication disturbances due to reflection and the like of EM waves, that enables greater thinness and lighter weight, and that has wide-band attenuation properties, as well as a manufacturing method of the wave absorber. The wave absorber of the present invention has a structure which sequentially laminates a grid-like conductor layer composed of an electric conductor, a first dielectric layer, a high-resistance conductor layer having a surface resistivity within a prescribed range, a second dielectric layer, and a pattern layer having multiple patterns composed of an electric conductor, wherein each pattern in said pattern layer differs in either or both of size and form relative to another adjacent pattern.
US07864092B2

A digital-to-thermometer-code converter is disclosed for converting a digital signal into its thermometer-code equivalent. Embodiments of the digital-to-thermometer-code include a binary-to-control signal converter that generates a column control signal and a row control signal based on a binary input signal, and a control signal-to-thermometer-code decoder that includes an array of decoder circuit blocks coupled to receive the column control signal and the row control signal, wherein each of the decoder circuit blocks determine at least one bit of the thermometer-code output signal based on at least a first bit of the column control signal.
US07864089B2

The present invention discloses an FFT-based ADC calibration system able to solve the problems of capacitor mismatch and finite Op-Amp open loop gain, which result in that the radix of the gain of each stage is not exactly equal to 2. The present invention uses an FFT processor to calculate the real radix of each stage and uses a digital method to generate new digital outputs. As the present invention can compensate the finite gain of Op-Amp, the specification of Op-Amp is not so critical in designing ADC. Therefore, the low-gain Op-Amp can be used to reduce the power consumption of ADC. Further, the FFT-based calibration technology can considerably promote the performance of ADC.
US07864087B2

A method for coding a message of a plurality of m-state symbols into a coded message of n-state symbols wherein n>m is disclosed. A method to make the distribution of states of n-state symbols a uniform distribution is also disclosed. A coding rule is initiated based on a distribution of states of m-state symbols. A method of coding the coding rule by transposition is also provided. In one embodiment a coded message of n-state symbols has symbols that each have a unique state. A system for executing the coding and decoding methods is also disclosed.
US07864083B2

Embodiments described herein relate to compression and decompression of data consisting of a one dimensional time series of floating point numbers. A compressor may comprise a lossless stage and in some embodiments a lossy stage in addition to the lossless stage. The lossy stage quantizes the data by discarding some of the least significant bits as specified by the user. The lossless stage uses a context mixing algorithm with two bit-wise predictive models whose predictions are combined and fed to an arithmetic coder. One model is a direct context model using the most significant bits of prior numeric samples as context. The other model is the output of an adaptive filter, in which the approximate predicted numeric value is used as context to model the actual value. A corresponding decompressor uses the same lossless model with the arithmetic coder replaced by an arithmetic decoder.
US07864082B2

A variable length code decoding device for decoding variable length code data, including: a table memory that stores a plurality of decoding process tables having a reference relationship therein; and a decoding control unit that is given a start address and an initial reference bit length of the table memory; and sequentially selects the decoding process tables according to the decoded data to control a process of decoding the variable length code data, wherein when referring to the decoding process table to perform an initial decoding of the variable length code data, the initial decoding process is conducted by a longer bit length to be clipped from the variable length code data for referring to the decoding process table than the bit length used when referring to the other portions of the decoding process table.
US07864081B2

An embodiment of the present inventions is a method for encoding/decoding data of variable length format and is used to omit unnecessary pieces of data for the purpose of improving processing performance, reducing the size of data on communication paths and efficiently using limited physical memory. As examples of such variable length encoding, BER compression and UTF-8 encoding of UNICODE text, etc., are cited. While the amount of data can be reduced through encoding, before the data is actually used, it is necessary to restore (decode) it to the original data, which requires a great deal of processing time. One aspect of the present invention is improving decoding by reducing the processing time required to decode the encoded data.
US07864079B1

Ternary (3-value) and higher, multi-value digital scramblers/descramblers in digital communications. The method and apparatus of the present invention includes the creation of ternary (3-value) and higher value truth tables that establish ternary and higher value scrambling functions which are its own descrambling functions. The invention directly codes by scrambling ternary and higher-value digital signals and directly decodes by descrambling with the same function. A disclosed application of the invention is the creation of composite ternary and higher-value scrambling devices and methods consisting of single scrambling devices or functions combined with ternary or higher value shift registers. Another disclosed application is the creation of ternary and higher-value spread spectrum digital signals. Another disclosed application is a composite ternary or higher value scrambling system, comprising an odd number of scrambling functions and the ability to be its own descrambler.
US07864076B2

The present invention relates to character arrangements, input methods and input device. More particularly, the present invention relates to Korean, English and symbols arrangements that are effectively arranged on a limited number of buttons, input methods using the character arrangements and input device thereof. The present invention provides fundamental and efficient character arrangements that can be applied to various input methods so that the user who is accustomed to another input method can input characters with the character arrangement of the present invention fast and efficiently.
US07864054B2

An apparatus for communicating with a RFID tag comprises: a container holder configured to detachably attach a container for including at least a RFID tag which contains a tag medium on which a RFID circuit element is arranged; and an apparatus magnetic-path forming portion configured to form a magnetic path for a communication magnetic flux in a feeding path of said tag medium in said container for including at least a RFID tag when said container for including at least a RFID tag is attached to said container holder.
US07864037B2

A method, system and computer program product for communicating pattern data is presented. A graphical event pattern is sent to an interconnected array of intelligent sensors. When intelligent sensors in the interconnected array determine that an event has occurred, the graphical event pattern is sent to a user. Thereafter, any data that supports the graphical event pattern is sent to the user. Thus, this supporting data is transmitted according to the graphical event pattern, rather than a header address.
US07864031B2

A school bus has a hinged stop arm, a bidirectional electric motor operatively connected to the hinged stop arm for pivoting the hinged stop arm between a stored position adjacent the school bus and a deployed position extending outwardly of the school bus, and a motor control module for controlling the bidirectional electric motor. A retainer arrangement is attached to the school bus for retaining the hinged stop arm in the stored position positively and a second control module is operatively connected to the motor control module. The retainer arrangement includes a servo motor and a lock member that is moved by the servo motor between a lock position retaining the hinged arm in the stored position and a release position allowing the hinged stop arm to be pivoted outwardly by the motor. The motor and the servo motor are operated by a common switch. The switch is moved to a first position when the hinged stop arm is in the stored position to move the lock member to the release position and after a predetermined time delay to automatically pivot the hinged stop arm to the deployed position. The switch is moved to a second position when the hinged stop arm is in the deployed position to pivot the hinged stop arm back to the stored position and after a predetermined time delay to automatically move the lock member to the lock position.
US07864020B2

A composite transformer includes a bobbin assembly, a magnetic core covering element and a magnetic core assembly. The bobbin assembly includes at least a first connecting part and a first channel, wherein at least a primary winding coil and at least a secondary winding coil are wound around the bobbin assembly. The magnetic core covering element includes a second channel and at least a second connecting part. The at least a second connecting part of the magnetic core covering element is coupled with the at least a first connecting part of the bobbin assembly, so that the magnetic core covering element is combined with the bobbin assembly. The magnetic core assembly is partially embedded into the first channel of the bobbin assembly and the second channel of the magnetic core covering element.
US07864016B1

Methods and structures for constructing a magnetic core of a coupled inductor. The method provides for constructing N-phase coupled inductors as both single and scalable magnetic structures, where N is an integer greater than 1. The method additionally describes how such a construction of the magnetic core may enhance the benefits of using the scalable N-phase coupled inductor. The first and second magnetic cores may be formed into shapes that, when coupled together, may form a single scalable magnetic core. For example, the cores can be fashioned into shapes such as a U, an I, an H, a ring, a rectangle, and a comb, that cooperatively form the single magnetic core.
US07864015B2

A flux-channeled high current inductor includes an inductor body having a first end and an opposite second end and a conductor extending through the inductor body. The conductor includes a plurality of separate channels through a cross-sectional area of the inductor body thereby directing magnetic flux inducted by a current flowing through the conductor into two or more cross-sectional areas and reducing flux density of a given single area. The inductor body may be formed of a first ferromagnetic plate and a second ferromagnetic plate. The inductor may be formed from a single component magnetic core and have one or more slits to define inductance. The inductor may be formed of a magnetic powder. A method is provided for manufacturing flux-channeled high current inductors.
US07864014B2

A mode-switching transformer comprising a first line in common mode and a second line in differential mode, each line comprising two sections in series respectively coupled with one of the two sections of the other line and all sections having the same lengths, the common mode line being connected in series with a capacitor, to lower the central frequency of the transformer passband, the λ/4 lengths of the sections being chosen to correspond to a central frequency greater than the central frequency desired for the transformer.
US07864010B2

An improved field emission system and method is provided that involves field emission structures having electric or magnetic field sources. The magnitudes, polarities, and positions of the magnetic or electric field sources are configured to have desirable correlation properties, which may be in accordance with a code. The correlation properties correspond to a desired spatial force function where spatial forces between field emission structures correspond to relative alignment, separation distance, and the spatial force function.
US07864009B2

An improved field emission system and method is provided that involves field emission structures having electric or magnetic field sources. The magnitudes, polarities, and positions of the magnetic or electric field sources are configured to have desirable correlation properties, which may be in accordance with a code. The correlation properties correspond to a desired spatial force function where spatial forces between field emission structures correspond to relative alignment, separation distance, and the spatial force function.
US07864003B2

A circuit breaker and method include main contacts configured to connect in an on position and be separated in an off position. A handle is coupled to one of the main contacts to adjust the contacts between the on position, the off position, a trip position and an over on position. Secondary contacts are configured to provide power when connected using the handle in the over on position, even when the main contacts are separated. A stop mechanism configured to maintain separation between the main contacts to enable testing using the secondary contacts to power a test circuit such that if a test passes, the stop mechanism is released to permit resetting of the main contacts.
US07863995B2

A transient voltage suppressing (TVS) circuit with uni-directional blocking and symmetric bi-directional blocking capabilities integrated with an electromagnetic interference (EMI) filter supported on a semiconductor substrate of a first conductivity type. The TVS circuit integrated with the EMI filter further includes a ground terminal disposed on the surface for the symmetric bi-directional blocking structure and at the bottom of the semiconductor substrate for the uni-directional blocking structure and an input and an output terminal disposed on a top surface with at least a Zener diode and a plurality of capacitors disposed in the semiconductor substrate to couple the ground terminal to the input and output terminals with a direct capacitive coupling without an intermediate floating body region.
US07863991B1

A VCO circuit having low jitter and low PSS (power supply sensitivity). The VCO circuit includes a first ring oscillator stage, a second ring oscillator stage coupled to the first ring oscillator stage, and a VCO input coupled to both the first ring oscillator stage and the second ring oscillator stage for receiving a control voltage. Each of the first ring oscillator stage and the second ring oscillator stage further includes a CMOS inverter with a plurality of cross coupled transistors to implement oscillation of the VCO circuit.
US07863983B2

A power amplifier subsystem that includes a first stage amplifier and a second stage amplifier. A first bias circuit is coupled to the first stage amplifier, and the first bias circuit has a variable impedance that increases with radio frequency (RF) power. A second bias circuit is coupled to the second stage amplifier, and the second bias circuit has impedance relatively fixed with respect to radio frequency (RF) power. According to an embodiment of the invention, the first bias circuit comprises a transistor having a collector current that increases as radio frequency (RF) power increases. The second bias circuit can have a relatively fixed impedance. A method of designing an amplifier subsystem, where transistor size and resistor values are selected to obtain the desired bias and linearity characteristics, or transistor size and resistor values are selected to operate within a selected range, and amplifier performance is adjusted by changing the bias control voltage.
US07863975B2

A calibration device for a power amplifier includes a calculation unit, a first storage unit and a multiplier. The calculation unit is utilized for generating a calibration factor according to a value of a characteristic parameter of the power amplifier. The first storage unit coupled to the calculation unit, for storing the calibration factor. The multiplier is coupled to the first storage unit and a baseband unit, for multiplying a baseband signal outputted from the baseband unit by the calibration factor for generating an input signal to the power amplifier.
US07863973B2

The invention relates to an operating panel arrangement, in particular for domestic appliances such as washing machines and tumble dryers. An operating panel has formed on its outside actuating sections and display sections for operating or monitoring purposes. An electrical circuit arrangement is coupled to the actuating sections and the display sections and is arranged in the region of the inside of the operating panel.In this case, the circuit arrangement has at least three electrodes, which are arranged in a manner distributed approximately parallel to the operating panel. The circuit arrangement has evaluation means which are designed to calculate the spatial position of an operating means in relation to the position of the three electrodes, to be precise by evaluating the fields between the electrodes and the operator. The actuating sections can be freely defined as positions of the operating means in the region of the outside of the operating panel.
US07863971B1

A configurable power controller and method for controlling power of a macro circuit block, such as a memory circuit, in multiple power modes is described to help minimize power consumption of the macro circuit block when the application environment for the macro circuit block is in a lower power mode than during its normal power mode.
US07863958B2

A clock signal duty cycle adjustment circuit includes a duty cycle correction circuit that receives a clock input signal that may need duty cycle correction. The duty cycle correction circuit may derive first and second differential clock signals from the clock input signal. The first and second differential clock signals may exhibit respective voltage offsets. The duty cycle correction circuit includes a voltage offset shift circuit that may shift the voltage offset that one of the first and second differential clock signals exhibits to adjust the effective duty cycle of a clock output signal. The duty cycle adjustment circuit derives the clock output signal from the voltage offset adjusted first and second differential clock signals in response to a duty cycle error signal.
US07863957B2

A duty cycle correction circuit includes a phase splitter configured to control a phase of a DLL clock signal to generate a rising clock signal and a falling clock signal, a clock delay unit configured to delay the rising clock signal and the falling clock signal in response to control signals to generate a delayed rising clock signal and a delayed falling clock signal, a duty ratio correction unit configured to generate a correction rising clock signal and a correction falling clock signal that toggle in response to an edge timing of the delayed rising clock signal and the delayed falling clock signal, and a delay control unit configured to detect duty cycles of the correction rising clock signal and the correction falling clock signal to generate the control signals.
US07863951B2

Methods are described for providing an adaptive trip point detector circuit that receives an input signal at an input signal node and generates an output signal at an output signal node, the output signal changing from a first value to a second value when the input signal exceeds a trip point reference value. In particular, the trip point reference value is adjusted to compensate for variations in process or temperature.
US07863949B2

Disclosed is a circuit configured to synchronize multiple signals received by one clock domain from a different asynchronous clock domain, when simultaneous movement of the signals between the clock domains is intended. In the circuit multiple essentially identical pipelined signal paths receive digital input signals. XOR gates are associated with each of the signal paths. Each XOR gate monitors activity in a given signal path and controls, directly or indirectly (depending upon the embodiment), advancement of signal processing in the other signal path(s) to ensure that, if warranted, output signals at the circuit output nodes are synchronized. In a two-signal path embodiment, advancement of signal processing in one signal path is triggered, whenever transitioning digital signals are detected within the other signal path. In an n-signal path advancement of signal processing is triggered in all signal paths, whenever transitioning digital signals are detected on at least one signal path.
US07863941B1

A circuit includes a differential circuit that generates a differential output signal at first and second output nodes. The circuit also includes a first variable capacitor coupled to the first output node of the differential circuit, and a second variable capacitor coupled to the second output node of the differential circuit. A control circuit controls capacitances of the first and the second variable capacitors in response to a measurement of the differential output signal.
US07863940B2

An envelope detecting circuit is provided. The envelope detecting circuit comprises a source degeneration circuit that amplifies an input differential signal, a differential gain stage that supplies a voltage proportional to the amplified signal, a potential hold circuit that holds the voltage supplied from the gain stage, a comparator circuit that compares the voltage held by the potential holding circuit with a reference potential to output a detect signal, and envelope level adjustment and selection unit that responds to the detect signal and outputs a control signal to the source degeneration circuit.
US07863937B2

A logic gate implements logical expressions. A least one logic gate input receives at least one input logic gate signal and at least one control signal. At least one output for produces a logic gate output signal. A nonlinear updater operates as a dynamically configurable element to produce a plurality of different logic gates as selected by the control signal. The nonlinear updater includes a nonlinear updater output. The nonlinear updater is configured to apply a nonlinear function to the input logic gate signal to produce the nonlinear updater output signal representing a logical expression being implemented by one of the plurality of different logic gates on the input logic gate signal. A comparator includes a comparator input that is adapted to receive a reference threshold value for producing the logical gate output signal based on a comparison of the nonlinear output signal to the reference threshold value.
US07863924B2

Pusher assemblies for use in microelectronic device testing systems and methods for using such pusher assemblies are disclosed herein. One particular embodiment of such a pusher assembly comprises a plate having a first side and a second side opposite the first side. An engagement assembly is removably coupled to the second side of the plate and positioned to contact a microfeature device being tested. The pusher assembly can include an urging member proximate the first side of the plate and configured to move the engagement assembly toward the device being tested. The pusher assembly can also include a heat transfer unit carried by the first side of the plate. In several embodiments, the pusher assembly can further include a plurality of pins carried by the engagement assembly such that the pins extend through the plate and engage the urging member to restrict axial movement of the urging member toward the device being tested.
US07863921B2

A circuit board (CB) and method for automatic testing of an electronic device under test (DUT). The circuit board (CB) has a first terminal (T1) for coupling to automatic test equipment (ATE) including a first signal generator (SG1), a second terminal (T2) for coupling to the device under test (DUT), a circuit path (W1) interconnecting the first and second terminals (T1, T2), and a PIN (Positive Intrinsic Negative) diode (D1) having one of its cathode (CA) and anode (AN) connected to the circuit path (W1). A third terminal (T3) for coupling to a second signal generator (SG2) is connected to the other of the cathode (CA) and anode (AN). The PIN diode (D1) is arranged so that the length of its connection with the circuit path (W1) is electrically short with respect to the signal frequency of the test signal.
US07863920B2

A method of conducting an electrostatic discharge test on an integrated circuit is described. The method comprises configuring a test board assembly to emulate characteristics of a system in which the integrated circuit is to be used, coupling the integrated circuit to the test board assembly, and applying an electrostatic discharge test signal of system-level type to the test board assembly.
US07863916B2

A device mounted apparatus includes a board on which a plurality of devices are mounted and a device cooling cover covering the plurality of devices, and formed inside it with a channel through which a refrigerant can flow. The device cooling cover includes a first cover covering only the measurement device among the plurality of devices, and a second cover covering only the power device among the plurality of devices. The first cover and the second cover are electrically insulated from each other.
US07863907B2

Methods for making and systems employing pressure and temperature sensors are described. Embodiments include a capacitive element including a first conductor plate and a second conductor plate. Each plate includes a conductor layer formed on a substrate. In a pressure sensor embodiment, seal is positioned at or near the edges of the conductor plates, and a gas retained in a gap defined between the plates. In a temperature sensor embodiment, the gap defined between the plates is in fluid communication with the external environment.
US07863894B2

A beamsplitter is arranged to split an incident laser beam into a pump beam and a detection beam. The pump beam passes through the beam splitter and then reflects from a pair of mirrors to a quarter waveplate into an NMR cell. After passing through the NMR cell, the pump beam reflects from a mirror to a first photodetector. The detection beam reflects from the beam splitter and propagates on a path perpendicular to the path of the pump beam through the NMR cell. After passing through the NMR cell, the detection beam is incident upon a polarizer. The polarized portion of the detection beam then is incident upon a photodetector. Electrical signals output from the first and second photodetectors may then be processed to determine the rotation rate of the NMR cell about a sensing axis.
US07863893B2

Example systems, methods, and apparatus facilitate providing a k-space line that is missing in an under-sampled time frame. The missing line is computed by applying a GRAPPA-operator to a known k-space line in the under-sampled time frame. One example method includes controlling a dynamic parallel magnetic resonance imaging (DpMRI) apparatus to acquire a first under-sampled time interleaved frame having at least one first k-space line and controlling the DpMRI apparatus to acquire a second under-sampled time interleaved frame having at least one second k-space line that neighbors the first k-space line. The method includes assembling a reference data set from the first under-sampled time frame and the second under-sampled time frame and then determining the GRAPPA-operator from neighboring k-space lines in the reference data set.
US07863887B2

A device utilizing an operating state detection technique is provided which makes it possible to accurately detect an abnormality of a high-frequency heating apparatus.
US07863879B2

An AC signal producer comprises a controlling unit, a Class-D switch circuit, and a low-pass filter. The control unit receives a DC signal and produces a PWM control signal via checking reference tables. The Class-D switch circuit receives the PWM control signal and outputs a square-wave signal. The low-pass filter converts the square-wave signal into the AC signal. Thereby, disadvantages associated with the utilization of an oscillator and a transformer to convert the DC signal to an AC signal could be solved.
US07863874B2

A linear voltage regulator is provided having a first transistor connected between a terminal for an input voltage and a terminal for an output voltage, a reference voltage source for producing a reference voltage, a first resistor, a second resistor, a second transistor, wherein the first resistor, the second resistor, and the second transistor are series-connected between the terminal for the output voltage and a reference voltage, and constitute a voltage divider, wherein a divided output voltage is present at a tap of the voltage divider, and also having a differential amplifier with an inverting input and a non-inverting input, wherein the inverting input is connected to the reference voltage source, the non-inverting input is connected to the tap of the voltage divider, and an output terminal of the differential amplifier is connected to a control terminal of the first transistor.
US07863872B2

The present invention discloses a buck-boost switching regulator, comprising: (1) a first loop including: a first and a second switch electrically connected with each other, the first switch having an end electrically connected with an input voltage, and the second switch having an end electrically connected with ground; and a first control circuit controlling the operation of the first and the second switch; (2) a second loop including: a third and a fourth switch electrically connected with each other, the third switch having an end electrically connected with ground, and the fourth switch having an end electrically connected with an output voltage; and a second control circuit controlling the operation of the third and the fourth switch; and (3) an inductor electrically connected between a node between the first and the second switch, and a node between the third and the fourth switch.
US07863870B2

A switched mode power supply (SMPS) may be operated with uncoupled output inductors. Overvoltage produced by “low-load” conditions may be controlled through use of an adaptive regulating bleeder. The bleeder may comprise a shunt regulator and a power dissipation resistor connected in parallel with a load of the SMPS. As load on the SMPS is reduced below a predetermined level, the shunt regulator may begin to conduct. Current may pass through the power dissipation resistor. Power dissipation may occur at a rate sufficient to maintain continuous conductance through an output inductor of the SMPS. During normal load operation, the shunt regulator may not conduct and inefficient dissipation of power through the resistor may be avoided.
US07863866B2

A system measures a temperature condition of a component of a mobile communication device, determines a battery of the mobile communication device based on the measured temperature condition, activates the determined battery, activates a temperature management device connected to the battery, and manages the measured temperature condition of the component with the temperature management device.
US07863862B2

A handheld electronic device that includes a first battery and a holster that includes a second battery and a charging apparatus. When the handheld electronic device and the holster are electrically connected together, the charging apparatus charges the first battery on the handheld electronic device from the second battery on the holster when the first battery charge has been depleted to a given level and the second battery charge is above a second given level. Alternatively, if the first battery charge is above a third given level the first battery charges the second battery if the second battery is not fully charged. The holster further includes a microcontroller that communicates with a microprocessor on the handheld electronic device to identify alerts and activate a notification device powered by the second battery on the holster.
US07863859B2

A sequential power transmission between a portable user-carried battery and first and second independent accessories. At least one primary inductive coupling coil is mounted on an article of apparel worn by the user, so as to place a primary coil adjacent a first intermediary inductive coupling coil on the first independent accessory. The energizing of the first intermediary coil energizes a second intermediary coil on the first independent accessory. The second intermediary coil, when energized, energizes a secondary coil on the second independent accessory for powering the use, including the charging of the batteries of that accessory.
US07863854B2

A heat exchange cooler capable of eliminating continuous radiation of high-frequency noise waves and reducing the man hour for the installation work, and a power circuit driving device used for it are provided. A commercial power transformer (311), which transforms commercial AC power (307) supplied from a heat generating element storing box to a specified range of voltage, is provided. Moreover, first relay (210) and second relay (212) are used for automatically switching a plurality of taps disposed at the coil of commercial power transformer (311) which keeps a wide range of commercial AC voltage from 200V to 250V in nominal voltage within a specified range of output voltage.
US07863849B2

A fan driver circuit for powering a fan with a linear voltage may be designed using digital design techniques, resulting in a testable, accurate circuit on a smaller die size. The fan driver circuit may be configured to receive a digital control signal, which may be a sequence of numeric values, e.g. multiple-bit binary numbers, each indicative of a desired present rotational speed of the fan. The fan driver circuit may be implemented using a digital modulator, e.g. a delta-sigma modulator, with a simple low-pass filter, e.g. an RC-filter at the output, and may use oversampling based on a system clock, to shift in-band noise to out-of-band frequencies, and digital interpolation to filter out unwanted images from the upsampled digital control signal. The delta-sigma modulator may be constructed as a first-order delta-sigma modulator using an error-feedback structure to reduce die size.
US07863847B2

A power unit which makes it possible to reduce power transmitted from a prime mover to a driven part via an electrical path, to thereby increase the efficiency of driving the driven part. A first rotating machine of the power unit inputs and outputs energy between a stator and first and second rotors thereof, via magnetic circuits formed by generation of a rotating magnetic field, and the rotating magnetic field, and the rotors rotate while maintaining a linear relation in which respective differences in rotational speed between the rotating magnetic field and the second rotor, and between the second and first rotors are equal. The rotors are mechanically connected to a prime mover and a transmission, respectively. A second rotating machine of the power unit is mechanically connected to a drive part without via the transmission, and electrically connected to the stator.
US07863844B2

A technology for correctly detecting a rotating position of a rotator at the time of rotation start. A rotation control apparatus controls rotation of a motor, which includes a stator provided with a plurality of coils and a rotor having magnetism. At the time of detecting a position of the motor when the motor is stopped, a control part supplies a current to a plurality of different paths including the coils, a stopped position detecting part measures the current flowing in each of the plurality of paths, judges the order of the measured current values, and a rotating position of the motor is detected based on the order. Based on a combination of a path showing the highest current value and a path showing the second highest current value, the stopped time position detecting part judges a position of the motor.
US07863838B2

A power supply system is provided with a plurality of driving motors, a power converter, and a plurality of power supplies which supply the driving motors with power and have different output voltages. Each power supply is connected with at least one driving motor through the power converter and with at least one driving motor through a path which does not include the power converter.
US07863831B2

A method includes rectifying AC power and controlling switching of first, second and third currents from and rectified power and a switching sequence that is locked to the AC cycle time by sensing an amplitude of at least one of the AC power and the rectified power. The first, second and third currents are conducted through corresponding first, second and third series of color light emitting devices of different colors. The switching sequence repeats at least twice each AC cycle time.
US07863826B2

An illumination control apparatus using a pulsating wave is disclosed, in which a pulsating power is supplied to an electric power supplied to a fluorescent light stabilizer which needs an AC voltage. The level of the same is varied and supplied to an illumination control, such as fluorescent light and common light, is possible based on an input power control of a stabilizer without changing an installation of a conventional fluorescent light and common light device and of the power construction. In addition, the electric power can be concurrently supplied to a plurality of stabilizers based on a capacity of apparatus without changing the construction of a conventional system.
US07863822B2

An operating element for a vehicle (1, 160) for operation of a function of vehicle (1, 160), especially by pressing on the operating element or touching the operating element, is designed in such a way that the operating element includes a front electrode (10, 21, 22, 31, 71, 91, 111) and a rear electrode (11, 32, 72), as well as a layer (12, 33, 73) arranged between the front electrode (10, 21, 22, 31, 71, 91, 111) and the rear electrode (11, 32, 72) having a dielectric elastomer.
US07863817B2

A lamp electrode includes a sealed tube for generating light when powered by an external power supply and a pair of electrodes formed on the ends of the sealed tube. Solder is filled into the space between each electrode and the sealed tube, and formed on the surface of the exterior surface of the electrodes. A method for forming the lamp electrode includes forming a cylindrically shaped electrode on an end of a sealed tube; maintaining a supply of solder in the liquid state; and dipping the end of the tube on which the electrode is formed into the solder.
US07863814B2

An organic electroluminescent device includes a substrate on which a pixel region is disposed, and a partition structure including a stack of an inorganic partition made of an inorganic material and an organic partition made of an organic material, and an inorganic protective layer made of an inorganic material covering the surfaces of the organic partition. The partition structure surrounds the pixel region. A pixel electrode is in contact with the partition structure. An organic luminescent layer is disposed over the pixel electrode and covered with a cathode.
US07863812B2

An emission layer of an organic light emitting diode (OLED) for emitting a white light includes a host material, a first luminescent dopant, and a second luminescent dopant. The host material has a peak emission wavelength of about 300 nm to about 530 nm. The first luminescent dopant has a peak emission wavelength of about 300 nm to about 530 nm. The second luminescent dopant has a peak emission wavelength of about 530 nm to about 720 nm.
US07863801B2

An acoustic wave device includes a piezoelectric substrate, IDT electrodes, temperature characteristic-improving layer, and frequency-adjusting layer arranged on the piezoelectric substrate in that order. The piezoelectric substrate has a negative temperature coefficient of frequency TCF. The temperature characteristic-improving layer is made of a material having a positive temperature coefficient of frequency TCF. The frequency-adjusting layer includes a glass thin-film having a velocity of transverse wave less than a velocity of transverse wave of the temperature characteristic-improving layer.
US07863799B1

The present invention combines electrostatic comb with parallel plate actuation in a novel design to create a robust low voltage MEMS Micromirror. Other unique advantages of the invention include the ability to close the comb fingers for additional reliability and protection during mirror snapping with over voltage.
US07863796B2

A motor includes a stator, a rotor, a shaft (50) and two end caps (10, 40), which are assembled together. According to the precision requirements, the outer circumference of the rotor core (20), and the outer circumference, the inner bore (33), the end surfaces of the stator core (30) are subjected to grind. The ground rotor core (20) is nested in the ground stator core inner bore (33), wherein the punched outer diameter of the rotor core (20) is equal to the punched diameter of the inner bore (33) of the stator core (30). The shaft (50) is pressed directly into the shaft bore of the rotor core (20) so as to tightly fit with the shaft bore of the rotor core (20).
US07863780B2

The disclosure relates to a safety switching device for a hazardous area defined by motor-driven components, the device being switchable into at least two control stages, wherein in a first control stage at least some of the motor-driven components can be switched into a state of reduced risk potential and in at least one second control stage at least some of the motor-driven components can be shut off, and wherein the safety switching device comprises an apparatus for determining the position of the safety switching device inside the hazardous area.
US07863771B2

A technique for operating a device at multiple different power levels dependent upon the amount of power received involves sensing the amount of power received and turning on circuit components if power is adequate. A device constructed according to the technique should have the ability to detect at least two different, non-zero, power levels and turn on circuits to the extent that sufficient power is detected.
US07863767B2

A turbine (2) driven electric power production system (1),—said turbine (2) arranged for being driven by a fluid (3) having a fluid speed (v) varying in time,—said turbine (2) connected to a hydrostatic displacement pump (6) further connected to a hydrostatic displacement motor (8) as part of a closed loop hydrostatic transmission system (7),—said motor (8) arranged for driving an electrical generator (9) supplying AC power (10) at a frequency (fg) near a given desired frequency (fdes), characterized by a closed loop system arranged for controlling a volumetric displacement (13) of the hydrostatic motor (8), comprising—a fluid speed meter (11m) arranged for producing a speed signal (11s) representing a speed (v) of said fluid (3), and—a rotational speed meter (12m) arranged for providing a rotational speed signal (12s) representing a rotational speed measurement (ω) of said turbine (2), —a motor displacement control system (15) for continuously receiving said speed signal (11s) and said rotational speed signal (12s) and arranged for calculating a control signal (16), —a volumetric displacement control actuator (17) on said hydrostatic motor, arranged for receiving said control signal (16) for continuously adjusting a volumetric displacement (d) of said hydrostatic motor (8) for maintaining a set turbine tip speed ratio (tsrset) and thereby providing an improved power efficiency of the power production system (1) during fluctuations in said fluid speed (v).
US07863765B2

A vertical shaft type windmill with arcuate hook shaped vane blade is composed of a tower, a rotary stand, a wind vane assembly, a generator and an electric controller. The present invention makes use of the wind power to drive the aforesaid structure to produce the mechanical power which being afterwards converted into the electrical power to supply various loads such as the domestic appliances, the public and roadway lighting. The structure is simply constructed, easy to fabricate and operate.
US07863761B2

An integrated circuit package system comprising: providing a substrate; attaching an integrated circuit die over the substrate; attaching a connector to the integrated circuit die and the substrate; and forming an encapsulant over the substrate, the integrated circuit die, and the connector and minimizing ambient gas deformation of the substrate to keep the connector from touching another connector.
US07863759B2

A package structure and method for preventing gold bonding wires from collapsing are disclosed. The structure is especially useful for those chips whose two n×1 arrays of bonding pads are on the chip center to be packaged on a BGA substrate. According to the first preferred embodiment, two dies having a redistribution layer formed thereon are introduced outer the bonding pad array on the chip so that the gold bonding wires can be divided into two sections each to connect the bonding pads with the redistribution layer and the redistribution layer with the gold fingers on the BGA substrate. According to the second embodiment, the gold bonding wires are fixed by the epoxy strips on the chips after bonding the bonding pads to the gold fingers but before pouring liquid encapsulated epoxy into a mold.
US07863758B2

An adhesive film composition includes a polyester-based thermoplastic resin, an elastomer resin containing at least one of a hydroxyl group, a carboxyl group, or an epoxy group, an epoxy resin, a phenol curing agent, one or more of a latent catalytic curing agent or a curing catalyst, a silane coupling agent, and a filler.
US07863754B2

A technique for manufacturing a low-cost, small volume, and highly integrated semiconductor device is provided. A characteristic of the present invention is that a semiconductor element formed by using a semiconductor thin film is transferred over a semiconductor element formed by using a semiconductor substrate by a transfer technique in order to manufacture a semiconductor device. Compared with the conventional manufacturing method, mass production of semiconductor devices with lower cost and higher throughput can be realized, and production cost per semiconductor device can be reduced.
US07863749B2

A dense boron-based or phosphorus-based dielectric material is provided. Specifically, the present invention provides a dense boron-based dielectric material comprised of boron and at least one of carbon, nitrogen, and hydrogen or a dense phosphorus-based dielectric comprised of phosphorus and nitrogen. The present invention also provides electronic structures containing the dense boron-based or phosphorus-based dielectric as an etch stop, a dielectric Cu capping material, a CMP stop layer, and/or a reactive ion etching mask in a ULSI back-end-of-the-line (BEOL) interconnect structure. A method of forming the inventive boron-based or phosphorus-based dielectric as well as the electronic structure containing the same are also described in the present invention.
US07863748B2

A bonded semiconductor structure includes a support substrate which carries a first electronic circuit, and an interconnect region carried by the support substrate. The interconnect region includes a capacitor and conductive line in communication with the first electronic circuit. The circuit includes a bonding layer carried by the interconnect region, and a bonded substrate coupled to the interconnect region through the bonding layer.
US07863732B2

A ball grid array package system comprising: forming a package base including: fabricating a heat spreader having an access port, attaching an integrated circuit die to the heat spreader, mounting a substrate around the integrated circuit die, and coupling an electrical interconnect between the integrated circuit die and the substrate; and coupling a second integrated circuit package to the substrate through the access port.
US07863730B2

A method for forming a heat spreader, and the heat spreader formed thereby, are disclosed. An array heat spreader having a plurality of connected heat spreader panels is formed. Slots are formed in opposing sides of the heat spreader panels. Legs are formed on and extending downwardly from each of the heat spreader panels in at least an opposing pair of the slots on the heat spreader panels. The legs are integral with the respective heat spreader panels from which they depend.
US07863725B2

Provided is a power device package including: a substrate including at least one first die attach region; at least one first power semiconductor chip and at least one second power semiconductor chip that are stacked in order on the first die attach region; at least one die attach paddle that is disposed between the at least one first power semiconductor chip and the at least one second power semiconductor chip, wherein the die attach paddle comprises an adhesive layer that is attached to a top surface of the first power semiconductor chip; a conductive pattern including a second die attach region, on which the second semiconductor chip is mounted, and a wire bonding region that is electrically connected to the second die attach region; and an interlayer member between the adhesive layer and the conductive pattern; and a plurality of firs leads electrically connected to at least one of the at least one first power semiconductor chip and the at least one second power semiconductor chip.
US07863724B2

A circuit substrate uses post-fed top side power supply connections to provide improved routing flexibility and lower power supply voltage drop/power loss. Plated-through holes are used near the outside edges of the substrate to provide power supply connections to the top metal layers of the substrate adjacent to the die, which act as power supply planes. Pins are inserted through the plated-through holes to further lower the resistance of the power supply path(s). The bottom ends of the pins may extend past the bottom of the substrate to provide solderable interconnects for the power supply connections, or the bottom ends of the pins may be soldered to “jog” circuit patterns on a bottom metal layer of the substrate which connect the pins to one or more power supply terminals of an integrated circuit package including the substrate.
US07863719B2

A semiconductor device of the invention includes a semiconductor substrate having a first insulating section formed on one surface thereof. A first conductive section is disposed on the one surface of the semiconductor substrate. A second insulating section is superimposed over the first insulating section and covers the first conductive section. A second conductive section is superimposed over the second insulating section. A third insulating section is disposed over the second insulating section and covers the second conductive section. These first conductive section, second insulating section, second conductive section, third insulating section, and terminal altogether constitute a structure. A third opening is formed between adjacent structures. The third opening is formed passing through the third and second insulating sections to expose the first insulating section.
US07863717B2

A package structure of an integrated circuit device comprises a copper foil substrate, an integrated circuit device, a plurality of metal wires and an encapsulation material. The copper foil substrate comprises an IC bonding area, a plurality of conductive areas and an insulating dielectric material. The integrated circuit device is mounted on the surface of the IC bonding area, and is electrically connected to the plurality of conductive areas through the metal wires. The insulating dielectric material is between the IC bonding area and the conductive areas, and is also between two adjacent conductive areas. In addition, the encapsulation material covers the IC bonding area, the conductive areas and the integrated circuit device.
US07863709B1

Methods and apparatuses directed to low base resistance bipolar junction transistor (BJT) devices are described herein. A low base resistance BJT device may include a collector layer, a base layer formed on the collector layer, a plurality of isolation trench lines formed in the base layer and extending into the collector layer, and a plurality of polysilicon lines formed on the base layer parallel to and overlapping the plurality of isolation trench lines. The base layer may be N-doped or P-doped.
US07863706B2

A circuit system includes: forming a first electrode over a substrate; applying a dielectric layer over the first electrode and the substrate; forming a second electrode over the dielectric layer; and forming a dielectric structure from the dielectric layer with the dielectric structure within a first horizontal boundary of the first electrode.
US07863704B2

A high fill-factor photosensor array is formed comprising a P-layer, an I-layer, one or more semiconductor structures adjacent to the I-layer and each coupled to a N-layer, an electrically conductive electrode formed on top of the P-layer, and an additional semiconductor structure, adjacent to the N-layer and which is electrically connected to a voltage bias source. The bias voltage applied to the additional semiconductor structure charges the additional semiconductor structure, thereby creating a tunneling effect between the N-layer and the P-layer, wherein electrons leave the N-layer and reach the P-layer and the electrically conductive layer. The electrons then migrate and distribute uniformly throughout the electrically conductive layer, which ensures a uniform bias voltage across to the entire photosensor array. The biasing scheme in this invention allows to achieve mass production of photosensors without the use of wire bonding.
US07863702B2

An image sensor package assembling method includes providing a substrate on which a plurality of image sensors are mounted; providing a housing strip having a plurality of housings arranged corresponding to an arrangement of the image sensors on the substrate, each of the housings having an aperture corresponding to an active surface of the corresponding image sensor and a cavity enclosing an edge of the corresponding image sensor; attaching a transparent cover plate sealing the apertures of the housings on the housing strip after attaching the housing strip on the substrate; and separating image sensor packages from each other by successively cutting the transparent cover, the housing strip and the substrate. Increased yield and production efficiency can be realized.
US07863699B2

Bonded wafer packages having first and second wafers bonded together forming a matrix of sealed devices, at least one of the wafers having a plurality of passive devices formed thereon, including at least one BAW resonator within each of the sealed devices, the first wafer having conductor filled through-holes forming electrical connections between the passive devices and connections assessable from outside the sealed devices, the bonded wafers being diced to form individual sealed devices. The devices may be duplexers, interstage filters or other circuits such as VCOs and RF circuits. Various embodiments are disclosed.
US07863697B2

A resonator includes a CMOS substrate having a first electrode and a second electrode. The CMOS substrate is configured to provide one or more control signals to the first electrode. The resonator also includes a resonator structure including a silicon material layer. The resonator structure is coupled to the CMOS substrate and configured to resonate in response to the one or more control signals.
US07863696B2

A semiconductor sensor includes: a semiconductor substrate; a plurality of piezoelectric thin films layered on the semiconductor substrate, the plurality of piezoelectric thin films including at least a pair of the piezoelectric thin films layered above and below; a pair of electrodes that are formed at an interface of at least the pair of the piezoelectric thin films layered above and below and excite surface acoustic waves; a thin film directly under a lowest-layer piezoelectric film of the piezoelectric thin films; a metal thin film that is formed at an interface of the lowest-layer piezoelectric thin film and the thin film, and facilitate a growth of a ridge-and-valley portion on a surface of an uppermost-layer piezoelectric thin film of the piezoelectric thin films; and a sensitive film for molecular adsorption formed on at least the ridge-and-valley portion on the uppermost-layer piezoelectric thin film.
US07863680B2

A semiconductor component includes a surface region. A modified doping region is provided in the edge region of the cell array. In the surface region or modified doping region the doping concentration is lowered and/or in the surface region or modified doping region the conductivity type is formed such that it is opposite to the conductivity type of the actual semiconductor material region, or in which a field plate region is provided.
US07863679B2

A vertical power MOSFET includes a semiconductor substrate including a trench, a gate electrode layer having a prescribed impurity concentration and being formed inside the trench, and a cap insulating layer having a lower impurity concentration than the impurity concentration of the gate electrode layer and covering the gate electrode layer to provide insulation.
US07863677B2

A semiconductor device and a method of fabricating the same are provided. The semiconductor device includes a plurality of active regions which are defined in a semiconductor substrate, a plurality of gate lines which are formed as zigzag lines, extend across the active regions, are symmetrically arranged, and define a plurality of first regions and a plurality of second regions therebetween, and wherein the first regions being narrower than the second regions. The semiconductor device further includes an insulation layer which defines a plurality of contact regions by filling empty spaces in the first regions between the gate lines and, extending from the first regions, and surrounding sidewalls of portions of the gate lines in the second regions, and wherein the contact regions partially exposing the active regions and a plurality of contacts which respectively fill the contact regions.
US07863674B2

In one aspect, the present invention teaches a multiple-gate transistor 130 that includes a semiconductor fin 134 formed in a portion of a bulk semiconductor substrate 132. A gate dielectric 144 overlies a portion of the semiconductor fin 134 and a gate electrode 146 overlies the gate dielectric 144. A source region 138 and a drain region 140 are formed in the semiconductor fin 134 oppositely adjacent the gate electrode 144. In the preferred embodiment, the bottom surface 150 of the gate electrode 146 is lower than either the source-substrate junction 154 or the drain-substrate junction 152.
US07863673B2

A non-volatile memory device includes a semiconductor substrate, first and second control gates, and first and second charge storage patterns. The semiconductor substrate includes a protruding active pin having a source region, a drain region and a channel region located between the source and drain regions. The first control gate is located on a first sidewall of the channel region, and the second control gate is located on a second sidewall of the channel region. The second second control gate is separated from the first control gate. The first charge storage pattern is located between the first sidewall and the first control gate, and the second charge storage pattern is located between the second sidewall and the second control gate.
US07863669B2

A nonvolatile semiconductor memory device includes a gate electrode provided on a channel region of a semiconductor layer and a floating gate provided on a back side of the semiconductor layer with a first insulating layer interposed therebetween.
US07863668B2

A semiconductor device includes a semiconductor substrate, a memory cell region provided on the semiconductor substrate, a word line provided on the memory cell region, a first gate insulating film provided in the memory cell region beneath the word line, a first floating gate electrode provided on the first gate insulating film, a second gate insulating film provided in the memory cell region beneath the word line, the second gate insulating film being different from the first gate insulating film in thickness, and a second floating gate electrode provided on the second gate insulating film.
US07863665B2

A method and structure for reducing cracks in a dielectric in contact with a metal structure. The metal structure comprises a first metal layer; a second metal layer disposed on, and in contact with the first metal layer, the second metal layer being stiffer than the first metal layer; a third metal layer disposed on, and in contact with the second metal layer, the second metal layer being stiffer than the third metal layer. An additional metal is included wherein the dielectric layer is disposed between the metal structure and the additional metal.
US07863659B2

A MOS type solid-state image pickup apparatus comprises: a semiconductor substrate having a light receiving surface; a plurality of photoelectric conversion elements arranged in an array manner on the light receiving surface; a plurality of layers of wirings that goes across the light receiving surface and are stacked above the semiconductor substrate, the wirings being connected to signal reading circuits each of which is provided in association with each of the photoelectric conversion elements; and an insulation layer interposed with the layers of wirings, wherein a first wiring, which connects to a gate of a MOS transistor forming a part of each of the signal reading circuits, is provided in a lower one of the layers of wirings, and a second wiring, which connects to a source or drain of the MOS transistor, is provided in an upper one of the layers of wirings.
US07863654B2

A method of closely interconnecting integrated circuits contained within a semiconductor wafer to electrical circuits surrounding the semiconductor wafer. Electrical interconnects are held to a minimum in length by making efficient use of polyimide or polymer as an inter-metal dielectric thus enabling the integration of very small integrated circuits within a larger circuit environment at a minimum cost in electrical circuit performance.
US07863652B2

To provide a semiconductor integrated circuit device advantageous against EM and ESD. A plurality of I/O cells; a power wire formed of a plurality of interconnect layers over the above-described I/O cells; a bonding pad formed in an upper layer of the power wire and in a position corresponding to the I/O cell; and lead-out areas capable of electrically coupling the I/O cell to the bonding pad are provided. The above-described power wire includes a first power wire and a second power wire, and the above-described I/O cell includes first elements coupled to the first power wire and second elements coupled to the second power wire. The first element is placed on the first power wire side, and the second element is placed on the second power wire side. The first power wire and the second power wire can allow for a high current due to the interconnect layers over the I/O cells, thus having robustness against EM and ESD.
US07863645B2

A double-gate semiconductor device provides a high breakdown voltage allowing for a large excursion of the output voltage that is useful for power applications. The double-gate semiconductor device may be considered a double-gate device including a MOS gate and a junction gate, in which the bias of the junction gate may be a function of the gate voltage of the MOS gate. The breakdown voltage of the double-gate semiconductor device is the sum of the breakdown voltages of the MOS gate and the junction gate. Because an individual junction gate has an intrinsically high breakdown voltage, the breakdown voltage of the double-gate semiconductor device is greater than the breakdown voltage of an individual MOS gate. The double-gate semiconductor device provides improved RF capability in addition to operability at higher power levels as compared to conventional transistor devices. The double-gate semiconductor device may also be fabricated in a higher spatial density configuration such that a common implantation between the MOS gate and the junction gate is eliminated.
US07863640B2

A circuit board for a light emitting diode package improved in heat radiation efficiency and a manufacturing method thereof. In a simple manufacturing process, insulating layers are formed by anodizing on a portion of a thermally conductive board body and plated with a conductive material. In the light emitting diode package, a board body is made of a thermally conductive metal. Insulating oxidation layers are formed at a pair of opposing edges of the board body. First conductive patterns are formed on the insulating oxidation layers, respectively. Also, second conductive patterns are formed in contact with the board body at a predetermined distance from the first conductive patterns, respectively. The light emitting diode package ensures heat generated from the light emitting diode to radiate faster and more effectively. Additionally, the insulating layers are formed integral with the board body by anodizing, thus enhancing productivity and durance.
US07863639B2

A light-emitting diode (LED) structure with an improved heat transfer path with a lower thermal resistance than conventional LED lamps is provided. For some embodiments, a surface-mountable light-emitting diode structure is provided having an active layer deposited on a metal substrate directly bonded to a metal plate that is substantially exposed for low thermal resistance by positioning it on the bottom of the light-emitting diode structure. This metal plate can then be soldered to a printed circuit board (PCB) that includes a heat sink. For some embodiments of the invention, the metal plate is thermally and electrically conductively connected through several heat conduction layers to a large heat sink that may be included in the structure.
US07863630B2

A light-emitting diode includes a substrate, a compound semiconductor layer including a p-n junction-type light-emitting part formed on the substrate, an electric conductor disposed on the compound semiconductor layer and formed of an electrically conductive material optically transparent to the light emitted from the light-emitting part and a high resistance layer possessing higher resistance than the electric conductor and provided in the middle between the compound semiconductor layer and the electric conductor. In the configuration of a light-emitting diode lamp, the electric conductor and the electrode disposed on the semiconductor layer on the side opposite to the electric conductor across the light-emitting layer are made to assume an equal electric potential by means of wire bonding. The light-emitting diode abounds in luminance and excels in electrostatic breakdown voltage.
US07863628B2

Disclosed is a light-emitting device using a transistor structure, including a substrate, a first gate electrode, a first insulating layer, a source electrode, a drain electrode, and a light-emitting layer formed between the source electrode and the drain electrode in a direction parallel to these electrodes. In the light-emitting device using the transistor structure, it is possible to adjust the mobility of electrons or holes and to selectively set a light-emitting region through the control of the magnitude of voltage applied to the gate electrode, thus increasing the lifespan of the light-emitting device, facilitating the manufacturing process thereof, and realizing light-emitting or light-receiving properties having high efficiency and high purity.
US07863627B2

An object is to suppress decrease in luminance and appearance of flicker of a still image and to control a threshold voltage of a transistor for driving an EL element even in a state where the EL element continues to emit light for a certain period. An n-channel transistor and a p-channel transistor are provided as driving transistors for driving a light-emitting element, and a polarity of a potential which is supplied from a data line is reversed every given period and supplied to gates of the driving transistors in each pixel, whereby the threshold voltages of the driving transistors are controlled and change of luminance of the light-emitting element due to the threshold voltage shifts of the driving transistors can be reduced.
US07863620B2

Disclosed is a thin film transistor substrate and a system for inspecting the same. The thin film transistor substrate comprises gate wiring formed on an insulation substrate and including gate lines, and gate electrodes and gate pads connected to the gate lines; a gate insulation layer covering the gate wiring; a semiconductor layer formed over the gate insulation layer; data wiring formed over the gate insulation layer and including data pads; a protection layer covering the data wiring; auxiliary pads connected to the data pads through contact holes formed in the protection layer; and a pad auxiliary layer formed protruding a predetermined height under the data pads. The inspection system for determining whether a thin film transistor substrate is defective, in which the thin film transistor substrate comprises gate wiring including gate lines, gate electrodes and gate pads, and data wiring including source electrodes and drain electrodes, includes a probe pin for contacting the gate pads or data pads and transmitting a corresponding signal, wherein a contact tip at a distal end of the probe pin for contacting the gate pads or the data pads is rounded, and a radius of the rounded contact tip is 2 μm or less, or the rounded contact tip is coated with gold (Au).
US07863615B2

A display unit includes, on an insulating substrate, a plurality of wirings formed to extend in different directions, a thin-film transistor, and a display element. At least one of the plurality of wirings is a divided wiring having a crossing portion formed at an intersection with the other of the plurality of wirings, and a main portion which is formed in a layer same as the other of the plurality of wirings with an insulating film in between and which is electrically connected to the crossing portion via an conductive connection provided in the insulating film. At least one of the main portion and the crossing portion includes a first layer and a second layer stacked in order from the insulating substrate side, the second layer being in direct contact with the first layer and made of a material of a higher melting point than the first layer.
US07863611B2

Semiconductor devices and circuits with use of transparent oxide film are provided. The semiconductor device having a P-type region and an N-type region, wherein amorphous oxides with electron carrier concentration less than 1018/cm3 is used for the N-type region.
US07863606B2

The present invention provides semiconductor-on-diamond devices, and methods for the formation thereof. In one aspect, a mold is provided which has an interface surface configured to inversely match a configuration intended for the device surface of a diamond layer. An adynamic diamond layer is then deposited upon the diamond interface surface of the mold, and a substrate is joined to the growth surface of the adynamic diamond layer. At least a portion of the mold can then be removed to expose the device surface of the diamond which has received a shape which inversely corresponds to the configuration of the mold's diamond interface surface. The mold can be formed of a suitable semiconductor material which is thinned to produce a final device. Optionally, a semiconductor material can be coupled to the diamond layer subsequent to removal of the mold.
US07863600B2

A field-effect transistor is provided. The field-effect transistor includes a gate electrode, a gate-insulating layer, source/drain electrodes, and an organic semiconductor layer constituting a channel region. The source/drain electrodes each include a conductive portion composed of a metal and an organic conductive material layer which at least partially covers the conductive portion and which is doped with a dopant. The channel region is composed of the organic semiconductor layer located between the source/drain electrodes. The channel region and each of the conductive portions is electrically connected through the organic conductive material layer.
US07863596B2

A ring shaped heater surrounds a chalcogenide region along the length of a cylindrical solid phase portion thereof defining a change phase memory element. The chalcogenide region is formed in a sub-lithographic pore, so that a relatively compact structure is achieved. Furthermore, the ring contact between the heater and the cylindrical solid phase portion results in a more gradual transition of resistance versus programming current, enabling multilevel memories to be formed.
US07863590B2

An apparatus having one or more UV bulbs arranged around a structural element and within an outer conductive element. The apparatus also contains an inner conductive element which extends the length of the apparatus. The inner and outer conductive elements are coupled to a microwave source to enable the UV bulbs to be powered.
US07863588B2

A lighting optical apparatus using a deep ultraviolet light source that are easy to adjust due to a configuration with fewer components, has high illuminant and illuminant uniformity on an irradiated surface are provided. The apparatus has a deep ultraviolet light source from which deep ultraviolet rays are emitted, a first double-sided cylindrical lens which has a cylindrical lens array on both sides with a configuration of cylinder axes intersecting at right angles, a second double-sided cylindrical lens which has a cylindrical lens array on both sides with a configuration of cylinder axes intersecting at right angles, and a condenser lens.
US07863582B2

An ion-beam source comprising: a plasma-generation unit for generating plasma and an ion-extraction unit for extraction and acceleration of ions from the aforementioned plasma, where the ion-extraction unit is made in the form of at least one grid under a negative potential. The plasma generating unit consists of a working chamber having a deeply immersed antenna cell. The cell contains a ferromagnetic core, a heat conductor with a heat sink, at least one inductive coil wound onto the ferromagnetic core, and a cap made from a dielectric material that sealingly covers the ferromagnetic core and the inductive coil.
US07863568B2

A sensor that is photosensitive vis-à-vis at least part of the radiation in the visible range and/or in the near infrared range installed on a vehicle, the sensor being associated with an objective having a first zone that is focused to infinity and a second zone focused in near field.
US07863563B2

Embodiments of the present invention provide an apparatus employing an electron beam to expose the structure of a micro device and produce an image of the structure. The apparatus includes an electron gun producing the electron beam; an electron beam column having one or more segments that shape, focus and/or deflect the electron beams; and one or more center tubes along the electron beam column that provides a high vacuum environment for and guiding the electron beam to a target object coated with an electron sensitive resist. At least one of the center tubes is a carbon tube made of solid carbon material.
US07863561B2

An apparatus for performing chemical analyses includes a mass spectrometry module and an interface module that processes sample materials for delivery to the mass spectrometry module. The interface module includes a vessel having an opening to access a vessel chamber, a door to block the opening, a sealing member disposed between the door and the vessel, and an interlock. The interlock is actuated by the sealing member if the door is in the closed position and the sealing member is properly disposed between the door and the vessel to seal the vessel. The sealing member alternatively includes an indicator portion that is visible to an operator if the door is in the closed position and the sealing member is properly disposed.
US07863560B2

The invention concerns a nebuliser with nanometric flow rate of a liquid effluent in a nebulising gas comprising at least arranged substantially concentric, a capillary tube for intake of the liquid effluent and a nebulising needle including a central channel fed with liquid effluent through the capillary tube, a chamber for intake of the nebulising gas feeding a nozzle for expelling the nebulising gas, the nebulising needle passing through the intake chamber and the nozzle expelling the nebulising gas, the nebulising needle including a outlet for the liquid effluent whereof the aperture diameter is less than 20 ?m, the ratio of the diameter of the outlet of the nozzle expelling the nebulising gas and the outlet of the nebulising needle being more than 10 The inventive nanometric flow rate nebuliser and nebulising installation are applicable in mass spectrometry of trace elements contained in intracellular or microbiological medium for example.
US07863557B2

A multi-turn Time of Plight mass analyzer is disclosed comprising a first electric sector (5) and a second electric sector (8). The second electric sector (8) is arranged orthogonal to the first electric sector (5). Ions may make multiple loops or circuits of the mass analyzer before being detected and mass analyzed enabling a high resolution mass analyzer to be provided. According to another embodiment the mass analyzer may have an open-loop geometry wherein the first electric sector is elongated and further electric sectors are arranged in a staggered manner along the length of the first electric sector. The first and second electric sectors (5,8) may be sub-divided into a plurality of electric sector segments.
US07863556B2

A mass spectrum is generated by a process in which, from a mass scan signal comprising original samples defining a peak, a subset of the original samples defining the peak is selected. One or more synthesized samples are synthesized from the subset of the original samples. The one or more synthesized samples provide a temporal resolution greater than the temporal resolution of the original samples. The one or more synthesized samples are summed with respective temporally-aligned accumulated samples to produce the mass spectrum. The accumulated samples are obtained from mass scan signals generated during respective previously-performed mass scan operations.
US07863555B2

An illumination apparatus includes; a first solid-state light source, a second solid-state light source, a first arrangement member provided with a first arrangement surface, a second arrangement member provided with a second arrangement surface, an optical unit configured to reduce a dispersion angle of a light beam. The first solid-state light source emits a light beam having a first directivity. The second solid-state light source emits a light beam having a second directivity greater than the first directivity. A distance from the second arrangement surface to the second light-entering surface is longer than a distance from the first arrangement surface to the first light-entering surface.
US07863538B2

The gas-metal arc welding of metal-core wile electrodes in the pure Ar shielding gas for carbon steel, low alloy steel, and ferritic stainless steel is described. Such shielding gas provides several benefits not realized ??the gas-metal arc welding process with solid wires. When compared to standard argon/oxygen containing gas mixtures normally used for metal cored wires, these benefits include reduced silicate islands on the weld surface for improved weld appearance, reduced welding fume, and lower weld spatter, all of which provide easier clean-up after the welding operation. Benefits also include reduced arc penetration desirable for welding on thinner materials or handling poor joint fit-up. Lower voltage requirement further makes it possible to weld on thinner materials. Lower oxygen content in the weld deposits provide better toughness and easier welding in all-positions.
US07863532B2

A key assembly (10) for use in a electronic device is provided. The key assembly (10) comprises a light guiding plate (18), a keypad (12), and a key seat (14). The key seat (14) has a number of positioning poles (1442). The light guiding plate (18) defined a number of aligning holes (184) corresponding to the positioning poles (1442) and the positioning poles (1442) pass through the aligning holes (184).
US07863530B2

A modular switching device is disclosed which includes a plurality of interconnected modules, the modules having a control device module and a pole cell module, the modules of the switching device being interconnected with a shaft adapted to transfer a torque required for operating the switching device from one module to another module. The modular switching device is configured such that each module has a shaft element, and the shaft transferring the torque is composed of directly interconnected shaft elements.
US07863519B2

The invention relates to electrical sensors, which are tight against longitudinal water, and to a process for a simple and cost efficient manufacture, with a tightly closed housing, a sensor element, at least one cable leading out of the housing, wherein the electrical conductors of the cable in the housing comprise a massive cross section without a cavity at least in one longitudinal section, a conductor seal seals the massive cross section against the lead insulation, a lead seal seals the lead insulation against the jacket of the cable, and against all other jackets, and a jacket seal seals the cable jacket against the housing.
US07863513B2

A synchronous player system is used for recording an ensemble between an automatic player piano and an audio player and playback therebetween; while a user is playing on the automatic player piano in ensemble with the audio player, reference characteristic data of the performance is extracted from the audio music data, and are stored in a memory together with the event codes; when the user instructs the synchronous player system to reproduce the performance in ensemble with the same piece of music recorded in another compact disc, the synchronous player system extracts objective characteristic data from the audio data recorded in the other compact disc, finds differences through a correlation analysis, by way of example, and rescheduling the timing to reproduce the note events for synchronously controlling the automatic player piano and audio player.
US07863512B2

There is provided a signal processing device for processing an audio signal, the signal processing device including: an onset time detection unit for detecting an onset time based on a level of the audio signal; and a beat length calculation unit for obtaining a beat length Q by: setting an objective function P(Q|X) and an auxiliary function, the objective function P(Q|X) representing a probability that, when an interval X between the onset times is given, the interval X is the beat length Q, the auxiliary function being for inducing an update of both the beat length Q and a tempo Z that results in a monotonous increase of the objective function P(Q|X); and repeating maximization of the auxiliary function to have the auxiliary function converge.
US07863505B2

According to the invention, there is provided seed and plants of the hybrid corn variety designated CH363113. The invention thus relates to the plants, seeds and tissue cultures of the variety CH363113, and to methods for producing a corn plant produced by crossing a corn plant of variety CH363113 with itself or with another corn plant, such as a plant of another variety. The invention further relates to genetic complements of plants of variety CH363113.
US07863502B2

Isolated nucleic acid fragments and recombinant constructs comprising such fragments encoding delta-8 desaturases along with a method of making long-chain polyunsaturated fatty acids (PUFAs) using these delta-8 desaturases in plants and oleaginous yeast.
US07863498B2

A disposable absorbent article worn about the lower torso of a wearer includes at least one pair of side panels connecting a first waist region to a second waist region forming a waist opening and a pair of leg openings. Each side panel includes a waist region, a hip region and a leg region wherein the waist region, the hip region and the leg region differs structurally, functionally and visually to provide an improved initial fit and sustained fit while exhibiting a garment-like appearance.
US07863495B2

A wound shield to manage repetitive access stress may include a conformable substrate to circumscribe a wound. Any suitable dressing may be secured to the conformable substrate providing separation between the wound and the dressing. The wound substrate may provide a site for attachment of adhesive dressings to shield the patient's skin from the pain of repetitive access and or removal of the dressings. A conformable substrate may be composed of one or more layers of any suitable material and may include adhesive on one or more surfaces to secure the substrate to the wound site and or to secure the dressing to the conformable substrate. A wound substrate may include strong adhesive to secure the substrate to the patients skin. The conformable wound substrate will be formed of any suitable non-absorbent material to permit long term application adjacent a wound. Thus many dressings may be applied and removed from a single wound substrate shielding the patient's skin from repetitive insult. A wound substrate according to the present disclosure may also be combined with a conformable frame to provide exudate management and or pressure distribution around a wound.
US07863492B2

This invention relates to a process for producing linear alkyl benzene and linear paraffins, the process including the steps of obtaining a hydrocarbon condensate containing olefins, paraffins and oxygenates from a low temperature Fischer-Tropsch reaction; a) fractionating a desired carbon number distribution from the hydrocarbon condensate to form a fractionated hydrocarbon condensate stream; b) extracting oxygenates from the fractionated hydrocarbon condensate stream from step a) to form a stream containing olefins and paraffins; c) alkylating the stream containing olefins and paraffins from step b) with benzene in the presence of a suitable alkylation catalyst; and d) recovering linear alkyl benzene and linear paraffin.
US07863491B1

A method is disclosed for continuously producing gas clathrates, comprising: introducing a reaction gas and a reaction liquid both required for clathrate formation into a reaction chamber; adjusting in the reaction chamber the conditions such that clathrates form; adjusting the conditions in an outlet port of the reaction chamber such that ice-containing clathrates form in the outlet port of the reaction chamber, and arranging a cooling device in the outlet port and within the outlet port, to block the outlet port on the reaction chamber side; comminuting the ice-containing clathrates into ice chips using a comminutor, downstream from the cooling device and upstream from a transport line connected to the outlet port for removing the ice chips from the transport line side of the outlet port; and transporting the ice chips containing clathrates away via the transport line connected to the outlet port.
US07863490B2

Process for the manufacture of 1,2-dichloroethane starting with a hydrocarbon source according to which: a) the hydrocarbon source is subjected to cracking which produces a mixture of products containing ethylene and other constituents; b) the mixture of products containing ethylene is conveyed to at least one storage reservoir; c) a chlorination reactor and/or an oxychlorination reactor is (are) supplied with the previously stored mixture of products containing ethylene, in which reactors most of the ethylene present is converted to 1,2-dichloroethane; d) the 1,2-dichloroethane obtained is separated from the streams of products derived from the chlorination and oxychlorination reactors.
US07863477B2

A polyester production process employing an esterification system that uses a distillation column to recover alcohol produced from an esterification zone and then utilizes the recovered alcohol to form a paste, which is recirculated back to the esterification zone with little or no cooling.
US07863471B2

The invention relates to a method for transesterification of at least one component comprising at least one ester group with at least one component comprising at least one hydroxyl group, wherein the red mud produced in the Bayer process used for producing aluminum is added to the method as a reaction-promoting component. The invention also relates to the use of carboxylic acid salts produced during the transesterification method as plant treating agents and as detergents in cleaning and washing agents. The invention also relates to the use of dealkalized red mud obtained by means of the method according to the invention as the iron-contributing component of an iron fertilizer which can be used in particular in agriculture and to which limestone can also be added.
US07863465B2

The present invention relates to novel enfumafungin derivatives of formula I and pharmaceutically acceptable salts thereof, their synthesis, and their use as inhibitors of (1,3)-β-D-glucan synthase. The present compounds and pharmaceutically acceptable salts thereof, as well as pharmaceutical compositions comprising the present compounds and pharmaceutically acceptable salts thereof, are useful for treating or preventing antifungal infections and associated diseases and conditions.
US07863449B2

The present invention relates to modulators of muscarinic receptors. The present invention also provides compositions comprising such modulators, and methods therewith for treating muscarinic receptor mediated diseases.
US07863446B2

Novel heterocyclic compounds of the general formula (I), their derivatives, analogs, tautomeric forms, stereoisomers, polymorphs, hydrates, solvates, pharmaceutically acceptable salts, pharmaceutical compositions, metabolites and prodrugs thereof are described. These compounds are useful in the treatment of immunological diseases, inflammation, pain disorder, rheumatoid arthritis; osteoporosis; multiple myeloma; uveititis; acute and chronic myelogenous leukemia; atherosclerosis; cancer; cachexia; ischemic-induced cell-damage; pancreatic beta cell destruction; osteoarthritis; rheumatoid spondylitis; gouty arthritis; inflammatory bowel disease; adult respiratory distress syndrome (ARDS); psoriasis; Crohn's disease; allergic rhinitis; ulcerative colitis; anaphylaxis; contact dermatitis; muscle degeneration; asthma; COPD; bone resorption diseases; multiple sclerosis; sepsis; septic shock; toxic shock syndrome and fever. More particularly these compounds are useful as PDE4 inhibitors, and useful for treating PDE4 mediated diseases.
US07863442B2

There is provided a process for the preparation of olanzapine comprising: i) reacting 4-amino-2-methyl-10H-thieno-[2,3-b][1,5]benzodiazepine and N-methylpiperazine in a C1 to C4 alcoholic solvent or mixture thereof at suitable temperature and for a suitable time, ii) cooling the reaction mixture, and iii) isolating the precipitated olanzapine.
US07863434B2

The present invention relates, in general, to granulocytic ehrlichia (GE) proteins. In particular, the present invention relates to nucleic acid molecules coding for GE S2, S7, S22, S23, C6.1, C6.2, S11, E8, E46#1, and E46#2 proteins; purified GE S2, S7, S22, S23, C6.1, C6.2, S11, E8, E46#1, and E46#2 proteins and polypeptides; recombinant nucleic acid molecules; cells containing the recombinant nucleic acid molecules; antibodies having binding affinity specifically to GE S2, S7, S22, S23, C6.1, C6.2, S11, E8, E46#1, and E46#2 proteins and polypeptides; hybridomas containing the antibodies; nucleic acid probes for the detection of nucleic acids encoding GE S2, S7, S22, S23, C6.1, C6.2, S11, E8, E46#1, and E46#2 proteins; a method of detecting nucleic acids encoding GE S2, S7, S22, S23, C6.1, C6.2, S11, E8, E46#1, and E46#2 proteins or polypeptides in a sample; kits containing nucleic acid probes or antibodies; bioassays using the nucleic acid sequence, protein or antibodies of this invention to diagnose, assess, or prognose a mammal afflicted with ehrlichiosis; therapeutic uses, specifically vaccines comprising S2, S7, S22, S23, C6.1, C6.2, S11, E8, E46#1, and E46#2 proteins or polypeptides or nucleic acids; and methods of preventing or inhibiting ehrlichiosis in an animal.
US07863428B2

This invention relates to hydrolase fluorogenic substrates with improved cell permeability, methods for the preparation thereof, and methods of measuring activities of hydrolases, particularly in cell-based assays. The substrates easily diffuse into the cells, where they are enzymatically processed to yield photostable fluorescent products, and are particularly fitted for visualising enzyme-derived activities in cell-based assays.
US07863421B2

Conjugates of a Factor VIII moiety and one or more water-soluble polymers are provided. Typically, the water-soluble polymer is poly(ethylene glycol) or a derivative thereof. Also provided are compositions comprising the conjugates, methods of making the conjugates, and methods of administering compositions comprising the conjugates to a patient.
US07863417B2

The invention relates to compounds and to the cosmetically acceptable salts thereof, which correspond to general formula (I), wherein: R1 represents H, —C(O)—R6, —SO2—R6 or —C(O)—XR6; R2 and R4, independent of one another, represent (CH2)n—NH2 or (CH2)3—NHC(NH)NH2; n equals 1 4; R3 represents linear or branched C1-C4 alkyl that is optionally substituted by hydroxy; R5 and R6, independent of one another, represent hydrogen, optionally substituted (C1-C24) alkyl, optionally substituted C2-C24 alkenyl, optionally substituted phenyl, optionally substituted phenyl-C1-C4 alkyl or 9-fluorenyl-methyl; X represents oxygen (—O—) or —NH—; or XR5 with X═O also represents the esters of a-tocopherol, tocotrienol or retinol, with the provision that R1 and R5 do not represent hydrogen and X does not represent oxygen at the same time. The invention also relates to the production of the compounds of general formula (I) and to a cosmetically active composition that contains at least one compound of formula (I).
US07863391B2

A curable silicone composition containing an organopolysiloxane that contains in one molecule at least one epoxy-containing organic group, has a polystyrene-referenced weight-average molecular weight at least 500, and is expressed by the following general unit formula: (RSiO3/2)x[R1aSiO(4-a)/2]y (where R represents a cycloalkyl group, and R1 represents hydrogen atom or a univalent organic group, except for an aromatic group and a cycloalkyl group, at least one R1 in one molecule being an epoxy-containing univalent organic group, and where the following condition is observed: 00; y>0; and x+y=1).
US07863380B2

An exemplary erucamide-free composition for making container closures or closure sealants includes a matrix polymer, a silicone lubricant such as poly(dimethyl)siloxane, and a slip aid comprising a saturated amide, oxidized polyethylene, or combination thereof.
US07863376B2

A composition is provided that includes a polymer matrix. A core having a core surface is embedded within the polymer matrix. A polymeric ligand passivates the core surface and has a moiety Y, where Y is a Diels-Alder group of a diene or dienophile. A polymeric linker has a complementary Diels-Alder group diene or dienophile to moiety Y and forms a Diels-Alder bond with the moiety Y. A composition is also provided that includes polymer matrix having a matrix surface. A core having a core surface is present on the matrix surface. A polymeric ligand passivates the core surface and has a moiety Y, where Y is Diels-Alder group of a diene or dienophile. The polymer matrix and polymeric ligand together define a matrix-ligand Flory-Huggins binary interaction function greater than 0.
US07863369B2

A composite material includes a polymer matrix and a pigment dispersed in the polymer matrix. The pigment includes an alumina hydrate particulate material and a dye. The dye is covalently bonded to a surface of the alumina hydrate particulate material.
US07863368B2

A propylene resin composition includes 0 to 80 wt % of a propylene polymer (A) having a DSC melting point of not less than 100° C., 5 to 85 wt % of a specific soft propylene copolymer (B), 0 to 40 wt % of one or more elastomers (C) selected from ethylene elastomers (C1) and styrene elastomers (C2), and 15 to 80 wt % of an inorganic filler (D) (the total of (A), (B), (C) and (D) is 100 wt %) The propylene resin composition contains the inorganic filler at a high proportion and shows excellent flexibility as well as high breaking elongation, low-temperature properties, whitening resistance, scratch resistance, abrasion resistance, stress absorption properties and flame retardancy.
US07863367B2

A surface treated calcium carbonate in which calcium carbonate is surface treated with a fatty acid surface treatment agent satisfying the following equation (a), and the surface treated calcium carbonate satisfying the following equation (b) is provided: C12+C14 85(%)  (a) and Pv 90(%),  (b) C12 is a ratio of a fatty acid surface treatment agent having an alkyl group of 12 carbon atoms, C14 is a ratio of a fatty acid surface treatment agent having an alkyl group of 14 carbon atoms, and Pv is a ratio of a volume (vol. %) precipitated in hexane. The surface treated calcium carbonate of the present invention can provide the resin compositions having slip resistance and slump resistance with a good balance between them, especially the resin compositions having an excellent slip resistance.
US07863366B2

Processes for preparing reinforced polymeric material and the materials formed therefrom are discussed herein. The processes generally include providing a polymeric matrix, providing single-wall carbon nanotubes (SWNT) or multiple-wall carbon nanotubes (MWNT), purifying by the nanotubes in a single step of dissolving a support and catalyst particles with an agent appropriate to the nature of the support to form a purified support, functionalising the purified support by reaction with an alkylamine to form a functionalized support, dispersing the nanotubes in the polymeric matrix by mixing in the molten state to form a mixture and optionally orienting the mixture by stretching.
US07863364B2

The invention relates to a process for making an article subject to dynamic loading, the process comprises: (i) shaping a polymer-containing composition in the green state, the composition comprising (a) a continuous phase of a polymeric component of at least 15 wt %, based on the total weight of the polymer component of a propylene elastomer having a heat of fusion of less than 70 J/g and an isotactic triad tacticity of 50 to 99% and optionally containing units derived from a diene, the polymeric component having a density of less than 0.9 g/cm3 and (b) from 20 to 120 phr, preferably 30 to 100 phr, most preferably 40 to 90 phr based on the total weight of the polymer component of a reinforcing filler component; and (c) a peroxide curative. The composition is combined with a fibrous reinforcement which is then cured to a cure state as determined by ODR @ 170° C., 30 min MH-ML of from 5 to 80 dNm. The invention especially relates to such processes when providing under Demattia testing conditions a crack length of less than 15 mm at room temperature over 90K cycles, preferably 10 mm, more preferably 7 mm, and most preferably 4 mm, and a 10% modulus of 0.7 to 10 MPa, preferably 1.4 to 9 MPa and most preferably 2 to 8 MPa.
US07863361B2

There is provided herein, in one specific embodiment, silicone composition(s) comprising unique combination(s) of silicone polymer and alkyltrisiloxane(s) which can produce silicone composition(s) with lower solids content than silicone compositions that use other than alkyltrisiloxane(s); while still maintaining a desirable viscosity.
US07863360B2

The present invention relates to an acrylic pressure sensitive adhesive composition, specifically, an acrylic pressure sensitive adhesive composition having improved anti-static properties, comprising acrylic copolymers, chelating agent which may form a bond with metal ion; and alkali metal salts, and prevent whitening appearance under high temperature and humidity condition as well as static electricity without change of the durability, transparency, and adhesion.
US07863357B2

The invention provides uncharged water-soluble silica-adsorbing polymers for suppressing electroendoosmotic flow and to reduce analyte-wall interactions in capillary electrophoresis. In one aspect of the invention, one or more of such polymers are employed as components of a separation medium for the separation of biomolecules, such as polynucleotides, polysaccharides, proteins, and the like, by capillary electrophoresis. Generally, such polymers are characterized by (i) water solubility over the temperature range between about 20° C. to about 50° C., (ii) concentration in a separation medium in the range between about 0.001% to about 10% (weight/volume), (iii) molecular weight in the range of about 5×103 to about 1×106 daltons, and (iv) absence of charged groups in an aqueous medium having pH in the range of about 6 to about 9. In one embodiment, polymers of the invention are selected from the group consisting of polylactams, such as polyvinylpyrrolidone; N,N-disubstituted polyacrylamides; and N-substituted polyacrylamides. In accordance with the method of the invention, a sufficient amount of polymer adsorbs to the capillary surface to establish a zone of high viscosity that shields the analyte from the wall and impedes the movement of an electrical double layer under an electric field.
US07863355B2

A moulding material for the production of highly flame resistant articles with a matrix of a thermoplastic and a particulate pigment dispersed therein is characterized in that the pigment is light-sensitive and changes colour under the influence of laser light and in that the pigment is a reaction product of at least one halogen-free flame retardant organic nitrogen base with (i) at least one mixed salt with at least two different cations and/or with (ii) a mixture of salt type compounds which on heating can be transformed into at least one salt type compound with at least two different cations, as in (i); wherein in variations (i) and (ii), at least one of the cations is selected from a group (A) of elements Ti, Cr, Mn, Fe, Co, Ni, Cu, Zn, Y, Zr, Nb, Mo, Ag, Sn, Sb, La, Pr, Ta, W and Ce and at least one further cation is selected from a group (B) of elements from periods 3 and 6 of groups II and III, periods 5 and 6 of group IV and periods 4 and 5 of groups III to VIII and the lanthanides of the periodic table of the elements.
US07863345B2

A process for producing a microparticulate hardening catalyst, comprising the steps of jetting a liquid composition containing epoxy resin hardening catalyst (A), monomer having an ethylenically unsaturated group (B) and photopolymerization initiator (C) through a minute nozzle into a gas so as to form microparticles; and while the microparticles are floating, irradiating the same with high-energy rays to thereby effect polymerization of the monomer having an ethylenically unsaturated group (B).
US07863343B2

Expandable polylactic acid resin particles including (a) a base resin containing a polylactic acid resin having at least 50 mol % of lactic acid monomer component units, (b) a polyolefin wax in an amount of 0.0001 to 1 part by weight per 100 parts by weight of the base resin, and (c) a blowing agent in an amount of 1 to 30% by weight based on the weight of the resin particles. The expandable resin particles can give expanded beads having an average cell diameter of 10 to 500 μm. The expanded beads can give in-mold foam moldings.
US07863337B2

Use of triacontanol in preparation of human medicaments for treatment of cancers, especially liver cancer, intestinal cancer, and lung cancer. Triacontanol can be formulated into many formulations, such as oral tablets, capsules, drop pills, sustained-released formulation, injectable solution, injectable powder, suspension, and emulsion.
US07863328B2

Compounds of the formula (1) in which R1, R2, X, Y and Z are as defined in the description, the processes for the preparation of these compounds, the uses thereof for the treatment of dyslipidaemia, atherosclerosis and diabetes, and the pharmaceutical compositions comprising them.
US07863325B2

The disclosure relates to a new crystalline form of genistein. The disclosed crystalline form is crystalline genistein sodium salt dihydrate. The disclosure also relates to the novel genistein salt composition represented by this crystalline form. Therapeutic compositions containing crystalline genistein sodium salt and a pharmaceutically acceptable carrier are described. The disclosure also relates to therapeutic methods comprising the step of administering to a patient in need thereof a therapeutically effective amount of a therapeutic composition containing the crystalline form of the disclosure or crystalline genistein sodium salt dihydrate.
US07863312B2

The invention provides substituted pyrazolidinone compounds, and methods of treatment and pharmaceutical compositions that utilize or comprise one or more such compounds. Compounds of the invention are useful for a variety of therapies, including treating or preventing preterm labor, dysmenorrhea, asthma, hypertension, infertility or fertility disorder, undesired blood clotting, preeclampsia or eclampsia, an eosinophil disorder, sexual dysfunction, osteoporosis and other destructive bone disease or disorder, and other diseases and disorders associated with the prostaglandin EP2 and/or EP4 receptors.
US07863304B2

Embodiments of this invention include novel analogs of Glycyl-Prolyl-Glutamate (GPE) and compositions containing such analogs of GPE. Of these, certain analogs have modified proline residues. Other embodiments of this invention include uses of analogs of GPE to protect neural cells from degeneration and/or death in response to injury or disease. Disorders treatable with compounds and compositions of this invention include hypoxia/ischemia, toxic injury, and chronic neurodegenerative disorders including Parkinson's disease.
US07863284B2

Cyclopenta[g]quinazolines of the formula (I): —wherein: A is a group OR or NR0R1 wherein R0 and R1 are each independently hydrogen C1-4 alkyl, C3-4 alkenyl, C3-4 alkynyl, C2-4 hydroxyalkyl, C2-4 halogenoalkyl or C1-4 cyanalkyl, or R0 and R1 together with the intermediate N form a five- or six-membered heterocyclic ring; p is an integer in the range 1 to 4; R2 is hydrogen, C1-4 alkyl, C3-4 alkenyl, C3-4 alkynyl, C2-4 hydroxyalkyl, C2-4 halogenoalkyl or C1-4 cyanoalkyl; Ar1 is phenylene, thiophenediyl, thiazolediyl, pyridinediyl or pyrimidinediyl which may optionally bear one or two substituents selected from halogeno, hydroxy, amino, nitro, cyano, trifluoromethyl, C1-4 alkyl and C1-4 alkoxy; and R3 is a group of one of the following formulae: -A1-Ar2-A2-Y1-A5-CON(R)CH(Y4)Y5-A8-X—Ar4 and pharmaceutically acceptable salts or esters thereof are of therapeutic value particularly in the treatment of cancer.
US07863283B2

The present invention relates to sulphoximine-substituted quinazoline derivatives of the formula (I), processes for their preparation and their use as a medicament for the treatment of various diseases.
US07863282B2

A compound of formula Ia: or a pharmaceutically acceptable salt thereof.
US07863276B2

Salt forms of potent modulators of peroxisome proliferator activated receptors, pharmaceutical compositions comprising the same, and methods of treating disease using the same are disclosed.
US07863275B2

The present invention discloses methods of treating diabetic gastroparesis by administering tetrahydrobiopterin or a derivative thereof.
US07863273B2

A substantially pure dextrorotatory isomer of zopiclone or a pharmaceutically acceptable salt thereof and crystalline forms thereof are provided. Also provided is a process for its preparation and pharmaceutical compositions containing same.
US07863266B2

The invention provides a novel chemical series of formula I, as well as methods of use thereof for binding to the benzodiazepine site of the GABAA receptor and modulating GABAA, and use of the compound of formula I for the treatment of GABAA receptor associated disorders. The general structure of formula I is shown below: The invention further provides a method of modulation of one or more GABAA subtypes in an animal comprising administering to the animal an effective amount of a compound of formula (I).
US07863262B2

Administration of an HNO/NO− donating compound, such as Angeli's salt, increases myocardial contractility while concomitantly lowering left ventricular preload in subjects experiencing heart failure. Moreover, administration of the HNO/NO− donating compound isopropylamine (IPA)/NO(Na(CH3)2CHNHN(O)NO) surprisingly exhibited positive inotropic effects in subjects experiencing heart failure that were superior to those caused by the HNO/NO− donating compound Angeli's salt. Additionally, in contrast to the effects observed with NO− donors, administration of an HNO/NO− donor in combination with a positive inotropic agent did not impair the positive inotropic effect of the positive inotropic agent. Further, HNO/NO− exerts its positive inotropic effect independent of the adrenergic system, increasing contractility even in subjects receiving beta-antagonist therapy.
US07863258B1

The invention discloses the nanoparticles composed of chitosan, poly-glutamic acid, and at least one antineoplastic drug or cancer therapeutic agent characterized with a positive surface charge and their enhanced permeability for paracellular drug and bioactive agent delivery.
US07863257B2

The invention discloses the nanoparticles composed of chitosan, poly-glutamic acid, and at least one protein drug or bioactive agent characterized with a positive surface charge and their enhanced permeability for paracellular protein drug and bioactive agent delivery.
US07863254B2

The invention provides methods for treating or preventing psychiatric and substance abuse disorders, involving administration of a therapeutically-effective amount of a cytosine-containing or cytidine-containing compound, creatine-containing compound, adenosine-containing, or adenosine-elevating compound to a mammal.
US07863249B2

The invention relates to novel forms of compounds displaying broad spectrum antibiotic activity, especially crystalline polymorphic forms and amorphous forms of such compounds, compositions comprising such crystalline polymorphic forms and amorphous forms of such compounds, processes for manufacture and use thereof. The compounds and compositions of the invention are useful in the pharmaceutical industry, for example, in the treatment or prevention of diseases or disorders associated with the use of antibiotics, chemotherapies, or antiviral therapies, including, but not limited to, colitis, for example, pseudo-membranous colitis; antibiotic associated diarrhea; and infections due to Clostridium difficile (“C. difficile”), Clostridium perfringens (“C. perfringens”), Staphylococcus species, for example, methicillin-resistant Staphylococcus, or Enterococcus including Vancomycin-resistant enterococci.
US07863240B2

The present invention relates to methods for the modulation of immune responses. More particularly, the invention relates to methods and uses of leptin for immuno-modulation of the balance between the Th1/Th2 responses and for the treatment of immune-related disorders. Specifically, the methods of the invention comprise shifting the Th1/Th2 cell balance towards the proinflammatory state. This modulation of the cell balance may be performed by increasing the activity and/or the expression of leptin in said subject, for instance by raising the amount of leptin. The amount of leptin in a subject may be increased by activating immunoregulatory cells, administering an immunomodulatory amount of leptin or a homologue, derivative, or functional fragment of leptin.
US07863238B2

Disclosed are a fusion protein comprising enzyme N-acetylgalactosamine-6-sulfate sulfatase and a short peptide consisting of 4-15 acidic amino acids attached to the enzyme on its N-terminal side, a pharmaceutical composition containing the fusion protein, and a method for treatment of type A Morquio disease using the fusion protein. Compared with the native enzyme protein, the fusion protein exhibits higher transferability to bone tissues and improved, higher stability in the blood.
US07863232B2

Carboxylic acid diesters are employed for treating, in particular for cleaning textile materials, and more particularly for removing paint stains from textile fibers to improve the cleaning thereof; the subject dicarboxylic acid diesters have the formula (I), R1—OOC-A-COO—R2, in which R1 and R2, which may be the same or different, are each a linear or branched, cyclic or non-cyclic C1-C20 alkyl, aryl, alkyaryl, or arylalkyl radical, and the group A represents a branched divalent C3-C10 alkylene radical.
US07863229B2

The pour point of a lubricating composition consisting essentially of from about 5 wt % to about 100 wt % of a Group III base stock and from 0 wt % to about 95 wt % of a Group IV base stock is reduced by incorporating in the lubricating composition an effective amount of a polyol ester represented by Formula I wherein x=OH or CH2OH; y=H, CH3, CH3CH2, or CH2OH; and R1 is an aliphatic hydrocarbyl group having from about 16 to about 30 carbon atoms.
US07863228B2

A multi-functional composition for use as an additive for fuels and lubricants. The composition includes an amination product of a hydrocarbyl substituted succinic acylating agent and a mixture containing an aliphatic polyamine and an aromatic polyamine. The molar ratio of aliphatic polyamine to aromatic polyamine in the mixture ranges from about 10:0.1 to about 0.1:10. The amination product contains at least about 0.1 molar equivalent of the polyamine mixture to 1 molar equivalent of the hydrocarbyl substituted succinic acylating agent.
US07863227B2

A method for improving the seal integrity, oxidation resistance, thermal breakdown deposit protection of lubricating oil by combining a base stock and/or base oil with a high molecular weight aromatic amine and a low boron content dispersant.
US07863222B2

As noted above, certain aspects of this disclosure relate to a library of nucleic acid vectors, as well as a method for making the same. In certain embodiments, the library of nucleic acid vectors comprises: a plurality of nucleic acid molecules of the following formula: S1—R—S2 wherein, in each nucleic acid of the plurality: S1 and S2 are each at least 15 nucleotides in length; S1 and S2 are complementary to each other along their entire length; either S1 or S2 is complementary along its entire length to a sequence in eukaryotic mRNA; and R is a six base recognition site for a restriction endonuclease; and wherein S1 and S2 vary in nucleotide sequence between different members of the plurality. A method for amplifying a circular nucleic acid is also provided.
US07863219B2

A heat-sensitive transfer image-receiving sheet comprising at least one receiving layer containing a polymer latex and at least one heat insulating layer containing a hollow polymer on a support, wherein the polymer latex contained in the receiving layer comprises a copolymer containing a repeating unit derived from an acrylic or methacrylic acid ester and the acrylic or methacrylic acid ester has an alcohol moiety having 8 or more carbon atoms.
US07863214B2

Provided is a metal catalyst complex for preparing a cyclic olefin-based polymer by addition polymerization of a cyclic olefin-based monomer, which is represented by Formula 1 below: [M(L1)x(L′2)y(L3)z]a[Ani]b   wherein M is a Group X metal; [M(L1)x(L′2)y(L3)z] is a cationic precatalyst; L1 is an anionic hydrocarbyl-containing ligand; L′2 is a neutral ligand; L3 is an N-heterocyclic carbene ligand; [Ani] is an anion capable of weakly coordinating with the metal M; x is 1 or 2; y is 0 to 4; z is 1 or 2; 2≦x+y+z≦6; a and b are each 1 to 10. The metal catalyst complex has an N-heterocyclic carbene ligand, and thus, is excellent in thermal stability and reactivity.
US07863208B2

A grey glass composition employing in its colorant portion at least iron (Fe2O3/FeO), cobalt and selenium is provided. The glass allows high visible transmission, and good IR absorption, while at the same time achieving desired grey color. In certain example embodiments, the colorant portion includes, or may consist essentially of: total iron (expressed as Fe2O3)0.20 to 0.35% selenium0.0002 to 0.0020% cobalt oxide0.0025 to 0.0060% titanium oxide  0 to 1.0% glass redox:<=.27; or 0.10 to 0.25.
US07863203B2

This invention relates to silicon precursor compositions for forming silicon-containing films by low temperature (e.g., <550° C.) chemical vapor deposition processes for fabrication of ULSI devices and device structures. Such silicon precursor compositions comprise at least a silane or disilane derivative that is substituted with at least one alkylhydrazine functional groups and is free of halogen substitutes.
US07863202B2

An integrated circuit can be formed with a high-k dielectric layer. A first titanium oxide layer is deposited over a substrate using a first ALD process. A first metal oxide layer is also deposited over the substrate using a second ALD process. A second titanium oxide layer is deposited over the substrate using a third ALD process and a second metal oxide layer is deposited over the substrate using a fourth ALD process. The first and second metal oxides are preferably strontium oxide and/or aluminum oxide.
US07863198B2

Methods and devices for controlling a growth rate of films in semiconductor structures are shown. Chemical vapor deposition methods and devices include the use of a reaction inhibitor that selectively varies a deposition rate along a surface. One specific method includes atomic layer deposition. One method shown provides high step coverage over features such as trenches in trench plate capacitors. Also shown are methods and devices to provide uniform batch reactor layer thicknesses. Also shown are methods for forming alloy layers with high control over composition. Also shown are methods to selectively control growth rate to provide growth only on selected surfaces.
US07863185B2

A semiconductor integrated circuit with tilted via connection and related method are provided, the circuit including a via layer having at least one tilted via, and a wireway layer having at least one elongated wireway disposed above the via layer, wherein the wireway connects to and partially overlaps the tilted via; and the method including forming a via layer, patterning a via trench in the via layer, forming a wireway layer, patterning an elongated wireway in the wireway layer, etching the patterned wireway and the patterned via, and filling the etched wireway and the etched via with a conductive material, wherein the filled wireway partially overlaps the filled via.
US07863182B2

The invention relates to a dicing die-bonding film having a pressure-sensitive adhesive layer (2) on a substrate material (1) and a die-bonding adhesive layer (3) on the pressure-sensitive adhesive layer (2), wherein the adhesion of the pressure-sensitive adhesive layer (2) to the die-bonding adhesive layer (3), as determined under the conditions of a peel angle of 15° and a peel point moving rate of 2.5 mm/sec. at 23° C., is different between a region (2a) corresponding to a work attachment region (3a) and a region (2b) corresponding to a part or the whole of the other region (3b), in the die-bonding adhesive layer (3), and satisfies the following relationship: adhesion of the pressure-sensitive adhesive layer (2a)
US07863172B2

A gallium nitride based semiconductor Schottky diode fabricated from a n+ doped GaN layer having a thickness between one and six microns disposed on a sapphire substrate; an n− doped GaN layer having a thickness greater than one micron disposed on said n+ GaN layer patterned into a plurality of elongated fingers and a metal layer disposed on the n− doped GaN layer and forming a Schottky junction therewith. The layer thicknesses and the length and width of the elongated fingers are optimized to achieve a device with breakdown voltage of greater than 500 volts, current capacity in excess of one ampere, and a forward voltage of less than three volts.
US07863171B2

By introducing a atomic species, such as carbon, fluorine and the like, into the drain and source regions, as well as in the body region, the junction leakage of SOI transistors may be significantly increased, thereby providing an enhanced leakage path for accumulated minority charge carriers. Consequently, fluctuations of the body potential may be significantly reduced, thereby improving the overall performance of advanced SOI devices. In particular embodiments, the mechanism may be selectively applied to threshold voltage sensitive device areas, such as static RAM areas.
US07863169B2

An anisotropic wet etch of a semiconductor layer generates facets joined by a ridge running along the center of a pattern in a dielectric hardmask layer on the semiconductor layer. The dielectric hardmask layer is removed and a conformal masking material layer is deposited. Angled ion implantation of Ge, B, Ga, In, As, P, Sb, or inert atoms is performed parallel to each of the two facets joined by the ridge causing damage to implanted portions of the masking material layer, which are removed selective to undamaged portions of the masking material layer along the ridge and having a constant width. The semiconductor layer and a dielectric oxide layer underneath are etched selective to the remaining portions of the dielectric nitride. Employing remaining portions of the dielectric oxide layer as an etch mask, the gate conductor layer is patterned to form gate conductor lines having a constant width.
US07863157B2

A photovoltaic cell device, e.g., solar cell, solar panel, and method of manufacture. The device has an optically transparent substrate comprises a first surface and a second surface. A first thickness of material (e.g., semiconductor material, single crystal material) having a first surface region and a second surface region is included. In a preferred embodiment, the surface region is overlying the first surface of the optically transparent substrate. The device has an optical coupling material provided between the first surface region of the thickness of material and the first surface of the optically transparent material. A second thickness of semiconductor material is overlying the second surface region to form a resulting thickness of semiconductor material.
US07863153B1

An efficient method is disclosed for creating different field oxide profiles in a local oxidation of silicon process (LOCOS process). The method comprises (1) forming a first portion of the field oxide with a first field oxide profile (e.g., an abrupt bird's beak profile) during a field oxide oxidation process, and (2) forming a second portion of the field oxide with a second field oxide profile (e.g., a graded bird's beak profile) during the field oxide oxidation process. A graded bird's beak profile enables higher breakdown voltages. An abrupt bird's beak profile enables higher packing densities. The method gives an integrated circuit designer the flexibility to create an appropriate field oxide profile at a desired location.
US07863150B2

A structure and method to produce an airgap on a substrate having a dielectric layer with a pattern transferred onto the dielectric layer and a self aligned block out mask transferred on the dielectric layer around the pattern.
US07863149B2

In a method for fabricating a capacitor that includes an electrode structure (80), an auxiliary layer (40) is formed over a substrate (10). A recess (60), which determines the shape of the electrode structure (80), is etched into the auxiliary layer (40), and the electrode structure of the capacitor is formed in the recess. As an example, the auxiliary layer can be a semiconductor layer (40).
US07863147B2

A semiconductor device and a fabrication method thereof are provided. The semiconductor device includes a semiconductor substrate which comprise a first type well and a second type well, and a plurality of junction regions therebetween, wherein each of the junction regions adjoins the first and the second type wells. A gate electrode disposed on the semiconductor substrate and overlies at least two of the junction regions. A source and a drain are in the semiconductor substrate oppositely adjacent to the gate electrode.
US07863146B2

Roughly described, transistor channel regions are elevated over the level of certain adjacent STI regions. Preferably the STI regions that are transversely adjacent to the diffusion regions are suppressed, as are STI regions that are longitudinally adjacent to N-channel diffusion regions. Preferably STI regions that are longitudinally adjacent to P-channel diffusions are not suppressed; preferably they have an elevation that is at least as high as that of the diffusion regions.
US07863144B2

Embodiments relate to a semiconductor device and a method for manufacturing the device, which suppresses off-current by improving the problem of leakage current due to hump characteristics, making it possible to maximize the reliability of the device. Embodiments relate to a method for manufacturing a semiconductor device including forming a well having two ends in a semiconductor substrate. A shallow trench isolation (STI) is formed by etching both ends of the well and the semiconductor substrate adjacent both ends of the well. A gate oxide film and a photoresist film are formed over the upper surface of the semiconductor substrate including the STI. The photoresist film is patterned for an impurity ion implant into one side area including the edge of the side wall of the STI. A barrier area is formed by implanting an impurity ion into one side area including the side wall edge of the STI using the patterned photoresist film as a mask.
US07863133B2

Non-volatile memory cell structures are described that are formed by a method including forming a first oxide layer on a horizontal strained substrate, forming at least one first recess through the first oxide layer to the strained substrate, and forming at least one vertical epitaxial structure in the recess. A crystal lattice of the vertical epitaxial structure is aligned with a crystal lattice of the strained substrate.
US07863117B2

An apparatus and method for a multilayer silicon over insulator (SOI) device is provided. In the multilayer SOI device, the crystal orientation of at least one active region of a device is different than the active region of at least another device. Where the multilayer SOI device has a first layer including a PMOS device with a silicon active region having a crystal orientation of [100], the second layer may be an NMOS device with a active region having a silicon layer having a crystal orientation of [110]. The second layer is bonded to the first layer. The method and apparatus can be extended to more than two layers thus forming a multilayer SOI device having a different crystal orientation at each layer. The multiple layer SOI device may form circuits of reduced surface area.
US07863116B2

It is an object of the present invention to provide a highly sophisticated functional IC card that can ensure security by preventing forgery such as changing a picture of a face, and display other images as well as the picture of a face. An IC card comprising a display device and a plurality of thin film integrated circuits; wherein driving of the display device is controlled by the plurality of thin film integrated circuits; a semiconductor element used for the plurality of thin film integrated circuits and the display device is formed by using a polycrystalline semiconductor film; the plurality of thin film integrated circuits are laminated; the display device and the plurality of thin film integrated circuits are equipped for the same printed wiring board; and the IC card has a thickness of from 0.05 mm to 1 mm.
US07863097B2

In one embodiment, a method of preparing detectors for oxide bonding to an integrated chip, e.g., a readout integrated chip, includes providing a wafer having a plurality of detector elements with bumps thereon. A floating oxide layer is formed surrounding each of the bumps at a top portion thereof. An oxide-to-oxide bond is formed between the floating oxide layer and an oxide layer of the integrated chip which is provided in between corresponding bumps of the integrated chip. The oxide-to-oxide bond enables the bumps on the detector elements and the bumps on the integrated chip to be intimately contacted with each other, and removes essentially all mechanical stresses on and between the bumps. In another embodiment, a device has an interconnect interface that includes the oxide-to-oxide bond and an electrical connection between the bumps on the detector elements and the bumps on the integrated chip.
US07863095B2

A layered chip package includes a plurality of layer portions stacked, each layer portion including a semiconductor chip having a first surface with a device formed thereon and a second surface opposite thereto. The plurality of layer portions include at least a pair of layer portions disposed such that the first surfaces of the respective semiconductor chips face toward each other. A manufacturing method for the layered chip package includes the steps of: fabricating a layered substructure by stacking a plurality of substructures each including a plurality of layer portions corresponding to the plurality of layer portions of the layered chip package; and fabricating a plurality of layered chip packages by using the layered substructure. The step of fabricating the layered substructure includes: fabricating a first and a second pre-polishing substructure each having a first surface and a second surface; bonding the pre-polishing substructures to each other such that their respective first surfaces face toward each other; and forming a first and a second substructure by polishing the second surfaces.
US07863093B2

An integrated circuit (IC) die includes two bonding pads, that share a common logical function, such as signal input or signal output, separated by the width of the die, and preferably on opposite sides of the die. System-in-package devices are produced by steps including directly electrically connecting one or the other bonding pad to bonding pads of other, functionally different IC dies, with the bonding pads of the other IC dies, to which are connected bonding pads of common logical function of the IC dies of the present invention, being functionally identical but geometrically different. Multichip package devices are produced by stacking the IC dies of the present invention with other IC dies and directly electrically connecting one or the other bonding pad to different bonding pads of the other IC dies.
US07863081B2

Provided is a field effect transistor having an organic semiconductor layer, in which crystal grains having a maximum diameter of 10 μm or more account for 25% or more of the surface area of the organic semiconductor layer. The organic semiconductor layer preferably contains 7 to 200 crystal grains having a maximum diameter of 10 μm or more per 0.01 mm2. The organic semiconductor layer preferably contains a porphyrin crystal.
US07863074B2

A method for forming a thin film photovoltaic device having patterned electrode films includes providing a soda lime glass substrate with an overlying lower electrode layer comprising a molybdenum material. The method further includes subjecting the lower electrode layer with one or more pulses of electromagnetic radiation from a laser source to ablate one or more patterns associated with one or more berm structures from the lower electrode layer. Furthermore, the method includes processing the lower electrode layer comprising the one or more patterns using a mechanical brush device to remove the one or more berm structures followed by treating the lower electrode layer comprising the one or more patterns free from the one or more berm structures. The method further includes forming a layer of photovoltaic material overlying the lower electrode layer and forming a first zinc oxide layer overlying the layer of photovoltaic material.
US07863071B1

The present invention includes a fabrication method to construct a combined MEMS device and IC on a silicon-on-insulator (SOI) wafer (MEMS-IC) using standard foundry IC processing techniques. The invention also includes the resulting MEMS-IC. Deposition layers are added to the SOI wafer and etched away to form interconnects for electronic components for the IC. In one embodiment of the present invention, standard foundry IC processing etching techniques may be used to etch away parts of the insulating layer and device layer of the SOI wafer to create fine gaps and other detailed mechanical features of the MEMS device. Finely detailed etching patterns may be added by using imprint lithography instead of using contact or optical lithography.
US07863069B2

A method of producing an integrated MEMS resonator includes providing a substrate including single crystal silicon and partially forming a resonator in a first portion of the substrate, the resonator having a resonating element formed by the substrate and an electrode, the resonating element and the electrode forming a variable capacitor. The method also includes forming circuitry in a second portion of the substrate, the circuitry configured for detecting capacitance of the variable capacitor and finish forming the resonator and integrating the resonator with the circuitry so that the electrode is in communication with the circuitry.
US07863068B2

A light emitting diode (LED) includes a p-n junction containing luminescent activator ions. The visible emission from the activator ions preferably complementing the band edge emission of the LED in order to produce an overall white emission from the LED. In a preferred embodiment, the LED has double heterojunction structure having a semiconductor active layer between two confinement layers. The semiconductor active layer includes activator ions preferably selected from among Eu3+, Tb3+, Dy3+, Pr3+, Tm3+, and Mn2+. The electron-hole pairs trapped within the active layer sensitize the activator ions, causing the activator ions to emit light.
US07863066B2

A method for making a multiple-wavelength opto-electronic device which may include providing a substrates and forming a plurality of active optical devices to be carried by the substrate and operating at different respective wavelengths. Moreover, each optical device may include a superlattice comprising a plurality of stacked groups of layers, and each group of layers may include a plurality of stacked semiconductor monolayers defining a base semiconductor portion and at least one non-semiconductor monolayer thereon.
US07863065B2

A method of forming a display substrate includes forming an array layer on a substrate, forming a passivation layer on the array layer, forming a photoresist pattern on the passivation layer corresponding to a gate line, a source line and a thin-film transistor of the array layer, etching the passivation layer using the photoresist pattern as a mask Non-uniformly surface treating a surface of the photoresist pattern, forming a transparent electrode layer on the substrate having the surface-treated photoresist pattern formed thereon and forming a pixel electrode. The forming a pixel electrode includes removing the photoresist pattern and the transparent electrode layer, such as by infiltrating a strip solution into the surface-treated photoresist pattern.
US07863064B2

A method of manufacturing an organic light emitting display includes: forming a transistor on a substrate; forming a cathode electrode on the transistor to be connected to a source or a drain of the transistor; forming a bank layer having an opening on the cathode electrode; allowing a natural oxide layer to form on the cathode electrode; removing the natural oxide layer from the cathode electrode; forming an insulating buffer layer on the cathode electrode; forming an organic light emitting layer on the insulating buffer layer; and forming an anode electrode on the organic light emitting layer.
US07863063B2

A method for fabricating a sealed cavity microstructure comprises the steps of: forming an insulation layer with a micro-electro-mechanical structure on an upper surface of a silicon substrate, the micro-electro-mechanical structure includes at least one suspended structure and at least one conductive structure between which is disposed a spacer region; after an etching, filling a sacrificial layer into the spacer region and on the surface of the conductive structure; forming holes in the sacrificial layer correspondingly to the conductive structure; depositing a cap layer into the holes and the surface; after removing the sacrificial layer, utilizing the clearance of the cap layer to carry out a further etching to realize the suspension of the micro-electro-mechanical structure; and finally, utilizing a sealing layer to achieve the sealing effect. By such arrangements, the exposure of the micro-electro-mechanical structure can be effectively prevented, and the final package cost can be reduced.
US07863059B2

A target substance detection method for detecting a target substance in a specimen, comprises the steps of contacting with a specimen a target substance detecting element comprised of a base, a metal structure and a first capturing body for capturing a target substance; contacting with the target substance detecting element a labeling material comprised of a labeling substance and a second capturing body for capturing a target substance; and acquiring an absorption spectrum (A) of the target substance detecting element contacted with the specimen and the labeling material, wherein the employed labeling substance is a substance that a slope of a tangent of an absorption spectrum (C) of the labeling substance at a peak wavelength (λz) of an absorption spectrum (B) of the target substance detecting element is larger than zero.
US07863053B2

A diagnostic test system for detecting the presence or absence of an analyte within a test sample is provided. For instance, the system may include a swab and a detection unit. The detection unit includes a first component that is capable of receiving the swab, the first component defining an insertion chamber within which a fluid is capable of being retained. The detection unit also includes a second component that defines a detection chamber within which an assay for detecting the presence or absence of the analyte is capable of being contained. The first component is rotatable relative to the second component from an inactive position to an active position. In the inactive position, the fluid remains substantially contained within the insertion chamber. In the active position, the fluid may flow from the insertion chamber to the detection chamber and contact the assay.
US07863035B2

The invention relates to fluidics as used in medical and diagnostic equipment and relates further to means for purifying, abstracting, filtering, detecting and/or measuring analytes in liquid samples.
US07863022B2

A method of amplifying nucleic acids and determining the amount of amplified nucleic acids uses magnetic detection. The detection can be performed during the amplification process of the nucleic acid. During the detection, the amplified nucleic acid is bound to a sensor via a biological molecule.
US07863019B2

There are disclosed Interleukin-15 Receptor (IL-15R) proteins, DNAs and expression vectors encoding IL-15R, and processes for producing IL-15R as products of recombinant cell cultures.
US07863008B2

The present invention relates to recombinant expression vectors which express segments of deoxyribonucleic acid that encode recombinant HIV and HCV antigens. These recombinant expression vectors are transformed into host cells and used in a method to express large quantities of these antigens. The invention also provides compositions containing certain of the isolated antigens, diagnostic systems containing these antigens and methods of assaying body fluids to detect the presence of antibodies against the antigens of the invention.
US07863003B2

Apparatus implements non-destructive quality control of substrates and printed biological microarrays. A method and apparatus are provided for implementing quality control of gel-based microarrays prepared by dispensing a gel-forming composition on a solid substrate. The method utilizes the difference between the wettability properties of a supporting substrate and a gel, where the gel is hydrophilic. Condensation of vapor of a chemically inert water-soluble liquid, such as water or glycerol, on the surface of a substrate under inspection creates a layer of tiny droplets that affect both transmission and scattering of light on the surface. A pattern of condensation, characterized by spatial distribution, average size of the droplets and spacing between the droplets, reflects variation in wetting properties of the substrate. The pattern of condensation circumscribes printed microarray features to be non-destructively imaged and analyzed.
US07863001B2

The present invention relates to genetic markers whose expression is correlated with breast cancer. Specifically, the invention provides sets of markers whose expression patterns can be used to differentiate clinical conditions associated with breast cancer, such as the presence or absence of the estrogen receptor ESR1, and BRCA1 and sporadic tumors, and to provide information on the likelihood of tumor distant metastases within five years of initial diagnosis. The invention relates to methods of using these markers to distinguish these conditions. The invention also relates to kits containing ready-to-use microarrays and computer software for data analysis using the statistical methods disclosed herein.
US07862997B2

The present invention provides a nucleic acid amplification primer which can detect CEA mRNA. Also provided are nucleic acid amplification primer sets, methods to amplify nucleic acid for detecting mRNA of the gene that encodes CEA, and a method for assisting cancer diagnosis.
US07862968B2

An electrophotographic photoreceptor includes an electroconductive substrate; and at least a photosensitive layer provided on the electroconductive substrate, wherein the electrophotographic photoreceptor has an outermost layer which contains microcapsules having a lubricating oil encompassed therein. The microcapsules may be composed of an inorganic porous particle or an organic polymer material, and the lubricating oil may be a silicone oil or a fluoro oil. Such a photoreceptor has a surface with excellent lubricity and is less susceptible to surface damage and filming from toner or the like while exhibiting good reuseability of toner.
US07862967B2

A photoconductor that includes a supporting substrate, a first photogenerating layer, a second photogenerating layer and at least one charge transport layer. The first photogenerating layer contains, for example, a phthalocyanine pigment, and the second photogenerating layer contains a different phthalocyanine pigment than the first photogenerating layer phthalocyanine.
US07862958B2

The invention provides an electrochemical generator having a retaining apparatus for maintaining a stack of electrochemical cells in a state of compression. The electrochemical generator comprises an assembly of electrochemical cells comprising a plurality of stacked electrochemical cells and a retaining apparatus comprising holding members positioned at each extremity of the assembly and anchoring devices maintaining the holding members at a predetermined distance from one another thereby maintaining the assembly under a state of compression.
US07862954B2

The present invention relates to and provides a fuel cell in which sealing can be reliably made for each unit cell, thereby, enabling thinning, facilitating maintenance, and enabling miniaturization and weight reduction, and enabling free shape design. A fuel cell of the present invention is characterized by comprising a sheet-like solid polymer electrolyte 1 and a pair of electrode plates 2, 3 arranged on both sides of the solid polymer electrolyte 1, and further comprising a pair of metallic plates 4, 5 arranged on both sides of the electrode plates 2, 3, and provided flow path grooves 9, and inlets 4c, 5c and outlets communicating with the flow path grooves, wherein the peripheral edges of the metallic plates 4, 5 are mechanically sealed with an insulation material 6 interposed between the metallic plates.
US07862952B2

According to the present invention, there is provided a membrane electrode composite module including a membrane electrode composite formed by sandwiching both surfaces of an electrolyte membrane between gas diffusion electrodes, an anode current collecting plate having fuel flow holes through which fuel flows, and a cathode current collecting plate having oxygen flow holes through which oxygen flows, wherein both surfaces of the membrane electrode composite are sandwiched between the anode current collecting plate and the cathode current collecting plate, the membrane electrode composite module further including films made of a synthetic resin (a first film and a second film) which are a base of the anode current collecting plate and a base of the cathode current collecting plate.
US07862947B2

A system includes a fuel cell stack, a power communication path, a first controller and a second controller. The fuel cell stack generates electrical power, and the power communication path is coupled between the fuel cell stack and a load of the system to communicate the electrical power to the load. The power communication path includes a switch, which is operable to selectively couple the fuel cell stack to the load and isolate the fuel cell stack from the load. The first controller has a first response time to control the fuel cell stack and control the power communication path. The second controller has a second response time, which is significantly less than the first response time to monitor the power communication path for a fault condition and take corrective action in response to detecting the fault condition.
US07862939B2

A fuel cell assembly has a housing defining an electricity generation/combustion chamber, and electricity generation/combustion means disposed within the housing. A fuel gas and an oxygen-containing gas are supplied to the electricity generation/combustion means, and a combustion gas formed within the electricity generation/combustion chamber is discharged from the electricity generation/combustion chamber. A heat exchanger having a first channel and a second channel is disposed on at least one surface of the housing, the combustion gas is discharged from the interior of the electricity generation/combustion chamber through the first channel of the heat exchanger, and one of the oxygen-containing gas and the fuel gas is supplied to the electricity generation/combustion means through the second channel of the heat exchanger. A plurality of electricity generation units are arranged in parallel within the housing, and each of the electricity generation units includes a cell stack constituting the electricity generation/combustion means.
US07862937B2

A fuel cell stack (1) performs power generation using an anode gas having hydrogen as its main component, and after a power generation reaction, the anode gas is discharged as anode effluent. The anode effluent is re-circulated into the anode gas through a return passage (5). The return passage (5) comprises a purge valve (8) which discharges the anode effluent to the outside of the passage. In this invention, calculation of a first energy loss caused by an increase in non-hydrogen components in the anode gas while the purge valve (8) is closed (S7, S28), and calculation of a second energy loss which corresponds to the amount of hydrogen lost from the anode gas by opening the purge valve (8) (S8, S29) are performed. By opening the purge valve (8) when the second energy loss equals or falls below the first energy loss, the start timing of purging is optimized.
US07862930B2

A negative electrode for a lithium ion battery with high capacity, excellent cycle performance, and discharge performance at high load. In the negative electrode for a lithium ion secondary battery including a current collector and an active material layer carried on the current collector: the active material layer includes silicon, and an element M incapable of forming an alloy with lithium; the proportion of element M is higher in a first side contacting the current collector than in a second side opposite to the first side, in the thickness direction of the active material layer; the element M is different from the element forming the current collector; and the active material layer does not include a binder.
US07862928B2

A can includes a body receiving an electrode assembly of a battery and a bottom wall protruding downward from the body and having a convex bottom surface such that the bottom wall does not bend toward an inner portion of the can when the body is compressed.
US07862922B2

The polymer electrolyte membrane according to the present invention includes a proton-conducting polymer including metal ions bound to polyalkylene oxide. The polymer electrolyte membrane can save manufacturing cost of a fuel cell and improve proton conductivity and mechanical strength.
US07862913B2

An improved structure for the construction of perpendicular recording media is disclosed. The structure includes a perpendicular recording layer with at least two oxide sublayers or a lower sublayer of a non-oxide. One structure includes an upper sublayer comprised of a Silicon-oxide, while a lower sublayer is comprised of a Tantalum-oxide. The structures provide for increased coercivity and corrosion resistance.
US07862910B2

The invention provides a substrate bearing a photocatalytic coating. In some embodiments, the coating includes a photocatalytic film comprising titania deposited over a layer comprising tungsten oxide, aluminum oxide, niobium oxide or zirconium oxide. Additionally or alternatively, the photocatalytic film can include both titania and a material selected from the group consisting of nitrogen, tantalum, copper and silica. The invention also provides methods of depositing such coatings.
US07862902B2

The invention describes a multi-layered bearing with a supporting metal layer, optionally a bearing metal layer disposed on top of it, an anti-friction layer on top of the latter as well as a wearing layer on top of it. The wearing layer is made from bismuth or a bismuth alloy and the anti-friction layer is made from a copper-bismuth or silver-bismuth alloy or silver.
US07862898B2

An adhesive composition comprising a multifunctional ethylenically unsaturated siloxane polymer, a monofunctional ethylenically unsaturated siloxane macromer, and a vinyl monomer is described. The adhesive composition is used to make adhesive articles that, when applied to a substrate, remain removable or repositionable, even after long periods of time. The adhesive composition may be used in transfer adhesive films, and in laminated articles suitable for use in optical applications.
US07862896B2

The present invention relates to core-shell resin particles (C2) each comprising one or more film-like shell layers (P) comprising a first resin (a) and a core layer (Q) comprising a second resin (b). The core-shell resin particle (C2) is characterized in that the weight ratio between (P) and (Q) is from 0.1:99.9 to 70:30, the volatile content in the resin particle (C2) is not more than 2 weight %, and the resin (a) has an initial softening temperature of 40 to 270° C., a Tg of 20 to 250° C., a flow temperature of 60 to 300° C., and the difference of the Tg and the flow temperature in a range of 0 to 120° C. The resin particles are excellent in electrostatic property, thermal storage stability and thermal properties, and exhibit a narrow particle diameter distribution.
US07862890B2

A biomedia apparatus comprising an elongated central core and a plurality of loops positioned along the central core adapted to collect organisms from water. The biomedia apparatus may further comprise at least one reinforcing member associated with the central core. In one embodiment, the biomedia apparatus is utilized in a trickle tower to treat wastewater. In another embodiment, the biomedia apparatus is utilized outside a power plant to minimize spat that is drawn into the plant through water intake valves.
US07862882B1

A re-positionable magnetic art apparatus which is provided in a variety of shapes and sizes. Characters of the apparatus are attracted to a sheet which underlies a picture within a frame, the frames provided in a variety of shapes. A clear laminate covering the picture separates the removably positionable characters from the picture, thereby providing for picture clarity throughout the life of the apparatus. Pictures are provided with characters which match both picture theme and picture scale, ensuring realistic artistic expression. Accessory character material is available which is printable on an inkjet printer.
US07862880B2

The invention concerns a film, in particular a stamping film, laminating film or sticker film, which has at least one anisotropic polymer layer of an at least partially oriented liquid crystal material. The anisotropic polymer layer has one or more first regions which form a first security feature and in which the anisotropic polymer layer has properties which linearly polarise or which rotate the direction of rotation, and one or more second regions which form a second security element and in which the anisotropic polymer layer has circularly polarising properties. The first security feature is visualised when viewed through a first polariser and the second security feature is visualised when viewed through a second polariser responsive to a different polarisation state from that of the first polariser.
US07862879B2

A fabric having one or more guides attached to a wear surface of the fabric so to encapsulate fifty percent or more of the fabric caliper. Advantageously, the encapsulation of the fabric by the guide, and not the chemical affinity of the materials, is the mechanism that attaches the guide and fabric. Consequently, the bond strength is equal to the tear strength of either the fabric or guide material alone.
US07862874B2

A method for producing a welded resin material contains steps of: superimposing a resin member having transmissibility to laser light and a resin member having absorptivity to laser light to form a contact part where the resin members are in contact with each other; forming a closed space that is adjacent to the contact part and faces one end of the contact part; and radiating the laser light from the resin member having transmissibility while pressing the resin members to each other through the contact part, so as to heat the contact part to melt a resin at the contact part, housing a resin excluded from the contact part through melting in the closed space, solidifying the resin melted at the contact part to weld the resin members.
US07862871B2

A plastic container for domestic washing machines comprising a bearing shell (1) that accommodates a plastic member (3) in an injection moulding process, said plastic member being more solid and of better quality than the plastic forming the container (5). The metal bearing shell (1) and the plastic member (3) that is injection-moulded thereinto form a structural unit onto which the corresponding plastic container (5) is injection-moulded.
US07862866B2

Methods form multi-color electrophoretic displays. The method includes providing a solution containing microcapsules, wherein the microcapsules comprise a shell that is transparent and a display medium within the shell, wherein the display medium comprised of either (a) at least two sets of differently colored particles in a substantially clear fluid, or (b) at least one set of colored particles in a differently colored fluid. The method includes dispensing the solution onto a substrate, wherein a display layer of microcapsules is formed on the substrate. The method includes positioning a conductive substrate adjacent to the substrate, wherein the substrate is located between the display layer and the conductive substrate, wherein the conductive substrate applies an electric field to at least one microcapsule of the display layer, wherein the sets of particles of each microcapsule in the display layer are movable within the microcapsule by the electric field to be displayed.
US07862855B2

In a method of controlling an effusion cell in a deposition system, including a crucible, a guiding pathway and an injection nozzle, a guiding pathway and an injection nozzle are heated. The crucible is heated after heating the guiding pathway and the injection nozzle. In addition, in cooling the effusion cell including a crucible, a guiding pathway and an injection nozzle, the crucible is cooled. The guiding pathway and the injection nozzle are cooled after cooling the crucible. This method has an advantage of enhancing uniformity of the organic layer formed on the substrate by preventing the clogging of the injection nozzle by deposition material vaporized in the crucible or splashing.
US07862854B2

A method for preparing a roofing membrane, and a membrane, having significantly less adhesive while retaining the same sealing properties. The reduction in the amount of adhesive significantly decreases the cost of raw materials needed for manufacturing the membrane and thus reduces the overall cost of the membrane itself.
US07862853B2

A method for manufacturing a magnetic recording medium with high reliability is provided, which can form a thin magnetic layer having a dry film thickness of, for example, 60 nm or less while the occurrence of defects on the surface is suppressed. In this method, a magnetic paint having a solid concentration NV (mass %) of 3≦NV≦8 is applied to a non-magnetic underlayer formed over a non-magnetic support to a wet film thickness Tw in a range of ≦2300 (nm).
US07862852B2

There is provided a method of manufacturing a tantalum condenser, in which a high-performing tantalum condenser is manufactured through a more simplified and higher-efficient process using simpler and economical equipment. The method of manufacturing a tantalum condenser including: preparing a tantalum pellet by sintering a tantalum powder; oxidizing the tantalum pellet to form a dielectric layer on a surface thereof; forming a polymer layer on the tantalum pellet having the dielectric layer formed on the surface thereof; and immersing the tantalum pellet having the polymer layer formed on the surface thereof in a polymer suspension to be subjected to chemical reformation.
US07862840B2

The invention describes the preparation, isolation and use of an extract of kiwi fruit for the treatment of a disease or condition related with, caused by or mediated by activity of human pancreatic lipase and/or human fatty acid synthase.
US07862825B2

The present disclosure provides methods and uses for controlling tight blood glucose levels in a subject comprising administering an effective amount of a somatostatin inhibitor. The present disclosure provides methods and uses for treating or preventing hypoglycemia in a subject comprising administering an effective amount of a somatostatin inhibitor.
US07862823B1

The invention concerns a pharmaceutical composition for treating or preventing a certain number of infections caused by pathogenic agents such as bacteria, comprising as immunogen, one or several polyosides derived from one or several pathogenic agents. The polyosides are in the form of conjugates, coupled with a carrier protein. The composition contains at least two types of conjugates, each being at least characterised by a different protein carrier.
US07862821B2

The present invention relates to an immunogenic or vaccine composition to induce an immune response or protective immune response against Orbiviruses, more specifically bluetongue virus (BTV) in an animal susceptible to BTV infection. The composition may include a pharmaceutically or veterinarily acceptable vehicle or excipient, and a vector. The vector may contain heterologous nucleic acid molecule(s), expresses in vivo in the animal BTV antigen, immunogen or epitope thereof, e.g., BTV VP2; BTV VP2 and VP5; BTV VP2 and VP5 and VP3 and/or VP7. The composition can contain an adjuvant, such as carbomer. Methods for making and using such a composition, including prime-boost regimes and including as to differential diagnosis, are also contemplated. AGACAGTGGTCAATTCCAATGGTACTGTTTGACGATAC
US07862817B2

The present application describes humanized anti-ErbB2 antibodies and methods for treating cancer with anti-ErbB2 antibodies, such as humanized anti-ErbB2 antibodies.
US07862797B2

Alkali metal oxide-metal oxide mixed oxide powder in the form of aggregates of pore-free primary particles, comprising from 0.005 to 5% by weight of at least one alkali metal oxide, which has a BET surface area of from 100 to 350 m2/g, has a specific DBP number, expressed as DBP number per square meter of specific surface area, greater than or equal to that of a powder which has only the metal oxide component, has the alkali metal oxide distributed in the core and on the surface of the primary particles. Silicone rubber comprising the alkali metal oxide-metal oxide mixed oxide powder.
US07862795B2

Methods of preparing single walled carbon nanotubes are provided. Carbon containing gas is contacted with a supported metal catalyst under reaction conditions to yield at least 90% single walled carbon nanotubes and at least 1 gram single walled carbon nanotubes/gram metal catalyst. The support material may be calcined at temperatures between 150 and 600° C., and may have at least one oxidized planar surface. Reaction conditions include less than 10 atmospheres pressure and less than 800° C.
US07862790B2

A plurality of carbide, such as silicon carbide, tungsten carbide, etc., nanofibrils predominantly having diameters substantially less than about 100 nm and a method for making such carbide nanofibrils. The method includes the steps of: heating a plurality of carbon nanotubes or nanofibrils predominantly having diameters less than about 50 nm in a reaction chamber in the presence of a gas of the form QnAm, where Q is a metal capable of forming a carbide, A is an element or radical and n and m are integers necessary to satisfy valences, such as, for example silicon monoxide, and an inert gas in a reaction vessel to a temperature substantially less than 1700 C but sufficently high to cause substantial reaction of the metal in the gas with the carbon of said carbon nanotubes or nanofibrils to form, in situ, solid carbide nanofibrils, the temperature being sufficiently low to prevent substantial fusing together of individidual ones of said carbide nanofibrils, removing at least a portion of A-based gas from said reaction chamber as said reaction progresses, and maintaining said temperature until substantially all the carbon of said nanotubes or nanofibrils has been converted into Q-based carbide.
US07862777B2

A coaxial tissue block puncher set comprises a carrier mechanism, the first, second and third operating mechanisms being respectively installed at proper positions thereon, while each of the operating mechanisms respectively has a base and a lifting unit being movingly installed on the base, wherein lifting unit of the first operating mechanism is movingly installed with a first punch needle tube, lifting unit of the second operating mechanism being movingly installed with a second punch needle tube is pierced through the first punch needle tube, and lifting unit of the third operating mechanism being movingly installed with a thimble is pierced through the second punch needle tube. Therefore, user is able to punch-extract relevant pathological paraffin and put to relevant position in the empty block thereby forming a tissue array without the need for tedious manual methods thus achieving the effectiveness of fastness, precision and easy operation, etc.
US07862766B2

Methods are provided for functionalizing a macroscopic film comprised of nanoscale fibers by controlled irradiation. The methods may include the steps of (a) providing a nanoscale fiber film material comprising a plurality of nanoscale fibers (which may include single wall nanotubes, multi-wall nanotubes, carbon nanofibers, or a combination thereof); and (b) irradiating the nanoscale fiber film material with a controlled amount of radiation in the open air or in a controlled atmosphere. The step of irradiating the nanoscale fiber film material is effective to functionalize the plurality of nanoscale fibers. Irradiated nanoscale fiber films are also provided having improved mechanical and electrical conducting properties.
US07862764B2

Electromagnetic (EM) drying of a plugged ware is provided that includes subjecting the ware to an axially non-uniform EM radiation field that causes more EM radiation to be dissipated in either of the plugged regions than in the unplugged region. The EM radiation field is provided by a configurable applicator system that includes a feed waveguide and a conveyor path. The feed waveguide includes configurable slots. The configurable applicator system can be set to selectively vary the amount of EM radiation dissipated by each ware along the longitudinal axis of each ware as a function of ware position along the conveying path, thereby enhancing the EM drying process.
US07862761B2

A pattern forming method for forming a pattern on a pattern forming material on a substrate by using an imprint pattern provided to a mold is constituted by preparing a substrate having thereon a pattern forming area, disposing the pattern forming material placed in an uncured state in the pattern forming area in a dispersion state at a plurality of positions at different intervals, and curing the pattern forming material in a state in which the pattern forming material is deformed in a shape corresponding to a shape of the imprint pattern provided to the mold.
US07862752B2

Apparatus and method for checking the venting of a mold having one or more vents, the apparatus comprising a vacuum source, a flow connection between the source and the mold, and a vacuum gauge connected to the flow connection, whereby vacuum measurement by the gauge correlates with total effective venting area of the mold.
US07862750B2

A device and a method are disclosed for producing an optical data medium, in particular high density optical media, such as the recently developed BlueRay™ disk for illumination with a blue laser (λ≈405 nm). The required thickness of the data and/or protective layers is of the order of at most several tenths of millimeters. Such thin layers are difficult to produce with conventional injection molding processes. The disclosed device and method solve this problem by overflowing an element placed in a narrow cavity with a low-viscosity material having a viscosity lower than the viscosity of polycarbonate, which then forms the data or protective layer, or by bonding a layer produced in this manner to another layer using a low-viscosity adhesive.
US07862749B2

A free-flowing, stable liquid flame retardant mixture comprised of or formed by mixing together components comprised of: A) at least one organic halogen-containing reactive flame retardant in which the halogen is bromine, chlorine or both; and B) a liquid additive that is comprised of at least one aliphatic polyepoxide of the formula R(EP)n, wherein R is a straight chain or branched chain aliphatic moiety which consists of carbon, hydrogen, and optionally, one or more ether oxygen atoms and/or one or more epoxy oxygen atoms; Ep is a terminal epoxy group: and n is a whole or fractional number in the range of 2 to about 6. Such mixtures can be effectively used in the preparation of flame retardant rigid polyurethanes and rigid foams thereof, and rigid polyisocyanurate and rigid foams thereof. Component B) serves as an effective hardener for such polymers and foams. It is preferable to include in the liquid flame retardant mixture one or more phosphorus-containing flame retardant additives such a fully-esterified ester of a pentavalent acid of phosphorus, e.g., an organic phosphate or organic phosphonate.
US07862745B2

The present invention provides a liquid crystalline polyester composition comprising (A) a liquid crystalline polyester having a solubility parameter σA of from 13 (cal/cm3)1/2 to 13.5 (cal/cm3)1/2 and (B) a polyhydric alcohol fatty acid ester having a solubility parameter σB of from 9 (cal/cm3)1/2 to 9.5 (cal/cm3)1/2, wherein the component (B) is contained in the amount of from 0.1 to 1 parts by weight on the basis of 100 parts by weight of the component (A). The composition has a good mold releasing property to dies in a melt molding at the time of producing a molded article by melt molding the composition and providing a molded article with sufficiently reduced blisters.
US07862741B2

The present invention relates to compositions for use in refrigeration, air-conditioning, and heat pump systems wherein the composition comprises a fluoroolefin and at least one other component. The compositions of the present invention are useful in processes for producing cooling or heat, as heat transfer fluids, foam blowing agents, aerosol propellants, and fire suppression and fire extinguishing agents.
US07862739B2

This invention relates to a refrigerant that is azeotropic or near-azeotropic and comprises a binary blend of R1270 and R161, R170 and R717, or R744 and R41. In a first embodiment, the binary blend has a molar composition of 50 to 80 percent R1270, the remainder being R161. In a second embodiment, the binary blend has a molar composition of 30 to 60 percent R717, the remainder being R170. In a third embodiment the binary blend has a molar composition of 20 to 60 percent R744, the remainder being R161.
US07862734B2

A method of fabricating an inkjet nozzle assembly having a seal member bridging between a moving portion and a stationary portion. The method includes the steps of: (a) providing a partially-fabricated printhead comprising a nozzle chamber sealed with a roof, (b) etching a via through the roof to define the moving portion on a first side of the via and the stationary portion on a second side of the via; (c) plugging the via with a plug of sacrificial material; (d) depositing a layer of flexible material over the plug; and (e) removing the plug to provide the inkjet nozzle assembly. The resultant seal member is comprised of the flexible material.
US07862724B2

A technique for extracting an objective component from a sample solution and obtaining the component in the form of equally separated powder aliquots is provided. A peak detector 12 detects the start point of the peak of the objective component on a chromatogram created from detection signals produced by a detector 5. Then, a controller 14 immediately changes a valve 6 so that the eluate will flow to a trap column 7a. A peak area processor 13 calculates the peak area of the objective component in real time. When the calculated area has exceeded a threshold, the controller 14 changes the valve 6 so that the eluate will flow to the next trap column 7b. Thus, the trap columns 7a to 7d are sequentially selected to divide the peak into one or more portions with the same area so that the objective component in the eluate will be sequentially captured by the trap columns 7a to 7d. Subsequently, the objective component is eluted from each trap column, and then the solvent is vaporized, to obtain powder of the objective component.
US07862717B2

An oil filter arrangement comprises a housing, which has a receiving chamber for a filter element which can be cross-flowed in a radial manner by oil and which can be inserted into the housing, a support tube which supports the filter element when it is inserted, a housing cover which closes the receiving chamber, and a drainage channel which is provided in the base area of the receiving chamber. The support tube is fixed to the housing and it remains therein when the filter element is replaced and that a drainage plate, which comprises closing means for closing the drainage channel and which is arranged in an axially displaceable manner, to a limited extent, on the support tube, is arranged in the base area of the receiving chamber.
US07862715B2

A method and apparatus for separating purifying media from a treated fluid. The method includes transporting the purifying media and the treated fluid along a substantially horizontal direction while a substantial quantity of purifying media fall along a substantially vertical direction relative to the treated fluid to generate a concentration of purifying media below the treated fluid. The falling purifying media are collected while releasing the treated fluid so as to separate the purifying media from the treated fluid.
US07862713B2

A system for reuse of water stored in a reservoir by transfer of initially filtered water from the reservoir to a vertically stacked filtration system located onshore. A flexible filter screened, porous feeder line housed within a perforated carrier pipe extends into the reservoir and is supported above the bottom of the reservoir for transfer of filtered water to the vertically stacked filtration system. The flexible filter screened, porous feeder line includes a conveyance system for retraction and extension of the porous feeder line by two cables. The feeder line is movable from the perforated carrier pipe for cleaning or replacement of the porous feeder line.
US07862712B2

A pool cleaning installation that circulates water of a pool filtering and cleaning the water, having a suction connection to a flexible hose of a suction type automated pool cleaner and a return to a Venturi (10) located in the weir (5) of the pool which has a return pipe (11) to the pool, so that the Venturi action draws water into the weir to skim debris off the pool surface to collect in a leaf basket. The operation of the automated pool cleaner on the pool bottom and walls is not affected should the surface debris clog the leaf basket in the weir.
US07862709B2

Compositions and methods are provided for separating bitumen from oil sands in an efficient and environmentally acceptable manner, and for recovering residual bitumen from existing tailings ponds.
US07862693B2

An electroplating apparatus for electroplating a surface of a wafer is provided. The wafer is capable of being electrically charged as a cathode. The electroplating apparatus includes a plating head capable of being positioned either over or under the surface of a wafer and capable of being electrically charged as an anode. The plating head is capable of enabling metallic plating between the surface of the wafer and the plating head when the wafer and plating head are charged. The plating head further comprises a voltage sensor pair capable of sensing a voltage present between the plating head and the surface of the wafer, and a controller capable of receiving data from the voltage sensor pair. The data received from the voltage sensor pair is used by the controller to maintain a substantially constant voltage to be applied by the anode when the plating head is placed in positions over the surface of the wafer. A method of electroplating a wafer is also provided.
US07862678B2

A method for making a plurality of electromechanical devices including attaching a laminar electromechanical structure to a receiving substrate using a not appreciably cured adhesive in a liquid state, laser cutting the laminar electromechanical structure while the adhesive is not appreciably cured to form a plurality of electromechanical devices, and curing the adhesive.
US07862675B1

A method for manufacturing a reinforced beam having a bonded tensile reinforcement member includes assembling a tensile reinforcement member to a beam, wherein adhesive is disposed between the tensile reinforcement member and the beam. A load is applied to the tensile reinforcement member to define a pre-tensioned tensile reinforcement member. A force is applied to urge the beam and the pre-tensioned tensile reinforcement member together. The load is released on the pre-tensioned tensile reinforcement member prior to the adhesive becoming cured, allowing longitudinal ends of the tensile reinforcement member to slide relative to the beam at longitudinal ends of the beam, and thereby forming a reinforced beam having a bonded tensile reinforcement member.
US07862669B2

The method of forming a lightweight, high performance, glass fiber blanket for acoustical and thermal insulation, that includes treating glass fibers with a fluid binding agent at elevated temperature to form a first cohesive glass fiber layer of thickness t1 traveling endwise, and winding that layer into a roll above a travel zone of that layer, repeating said treating to form a second cohesive glass fiber layer of thickness t2 traveling endwise over said zone below said roll and into an oven, and unrolling said first layer from said roll to travel into the oven in overlying surface to surface contacting relation to the traveling second layer, subjecting said layers to heat treatment and pressurization in the oven to compress the first and second layers to a controlled density thickness t3 which is substantially less than t1 and t2, and to progressively bond said first and second layers together in laminated relation to form the blanket, and removing said laminated product from the oven.
US07862662B2

Methods for cleaning using a tri-state body are disclosed. A substrate having a particle deposited thereon is provided. A tri-state body that has a solid portion, liquid portion, and a gas portion is generated. A force is applied over the tri-state body to promulgate an interaction between the solid portion and the particle. The tri-state body is removed along with the particle from the surface of the substrate. The interaction between the solid portion and the particle causing the particle to be removed along with the tri-state body.
US07862660B2

A method for cleaning interior surfaces of a header region of a hemodialyzer includes steps of: introducing an insertion device having an end portion and a shaft through a hemodialyzer plug port so that the end portion of the insertion device is within the header region; rotating the shaft at a speed sufficient to generate mechanical stresses for the removal of contaminants from interior surfaces of the header region; removing the insertion device from the header region; and rinsing and flushing away the removed contaminants from the header region. An apparatus and an insertion device for cleaning a header region of a hemodialyzer are disclosed.
US07862649B2

A particulate matter detection device includes a collection electrode that collects the particulate matter, a discharge electrode that allows a corona discharge to occur when a voltage is applied between the collection electrode and the discharge electrode, a measurement electrode, the impedance between the collection electrode and the measurement electrode changing when the collection electrode has collected the particulate matter, and a measurement section that detects a change in the impedance between the collection electrode and the measurement electrode, the particulate matter detection device detecting the particulate matter by charging the particulate matter contained in the gas by utilizing the corona discharge, collecting the charged particulate matter by the collection electrode by utilizing an electrostatic force, and detecting a change in the impedance between the collection electrode that has collected the particulate matter and the measurement electrode using the measurement section.
US07862645B2

Method for argon recovery that comprises (a) providing a feed gas mixture comprising argon and nitrogen; (b) contacting at least a portion of the feed gas mixture with a nitrogen-selective adsorbent in a cyclic pressure swing adsorption process and adsorbing at least a portion of the nitrogen on the adsorbent in a first pressure range above 100 psia to provide a purified argon product and an adsorbent comprising adsorbed nitrogen; and (c) desorbing the adsorbed nitrogen in one or more regeneration steps effected in a second pressure range between atmospheric pressure and a super-atmospheric pressure below any pressure in the first pressure range, inclusive; wherein the cyclic pressure swing adsorption process is effected at an average operating temperature of at least about 0° C.
US07862642B2

An improved granular-type urea fertilizer having an extended or slow release nitrogen component in which a non-thermosetting urea-formaldehyde resin concentrate is used to provide the granular fertilizer with an extended-release nitrogen component.
US07862639B2

An intake filter for an internal combustion engine for a motor vehicle including an unfiltered air intake region, a filter medium and a filtered air conduit, in which the unfiltered air intake region is arranged beneath the engine hood of the motor vehicle and is attached to the engine hood. The filter medium is tubular body which has a porosity that ensures a sufficient filtration of the intake air for the internal combustion engine.
US07862637B2

A multi-cyclone dust separator is provided, including a first cyclone unit that centrifugally separates dust from dust-laden air drawn into the first cyclone unit through a first air inlet, and a second cyclone unit that is formed inside the first cyclone unit, wherein the second cyclone unit includes a second cyclone body that has a second air inlet through which the air, from which the dust is separated by the first cyclone unit, enters the second cyclone body, and a guide unit that enables the air entering the second cyclone unit to be rotated.
US07862633B2

A system and method for creating reformate with decreased carbon deposition. The system is made up of a steam source, a superheater, a fuel injection device, a prereformer, and a reformer with catalyst linings. The system functions to superheat steam while maintaining the fuel at a lower temperature prior to injection and mixing with the steam. After injection and mixing, the steam and fuel mixture is then passed through a prereformer where catalysts treat a portion of the fuel and steam mixture. After these portions are treated with a catalyst, the mixture is passed through to a reformer where further treatment of the material by catalyst takes place.
US07862628B2

A hydrocarbonaceous fuel additive, fuel composition, and method all lower both carbon particulate emissions and improve slag properties in combustion systems including, for instance, utility furnaces and boiler systems. The mixed metal catalyst may include a transition metal-containing compound, an alkali metal compound, and a magnesium-containing compound.
US07862623B1

A portable surface cleaning apparatus comprises a base module for movement along the surface; an upright handle pivotally attached to the base module; a fluid dispensing system including at least one fluid supply tank mounted to the handle or the base module, a dispensing nozzle mounted to the base module for applying a cleaning fluid to an upholstery or carpet surface to be cleaned, and a heater for heating the fluid to be applied to the surface to be cleaned to a temperature less than boiling; a fluid recovery tank mounted to the handle or the base module for holding recovered fluid; a suction nozzle associated with the base module; a working air conduit extending between the recovery tank and the suction nozzle; and a vacuum source and fluid communication with the recovery tank for generating a flow of working air from the suction nozzle through the working air conduit and through the recovery tank to thereby recovering fluid from the surface to be cleaned through the suction nozzle and working air conduit and into the recovery tank. A method for cleaning an upholstery or carpet surface in which a fluid cleaning solution is contained in a tank and dispensed on the surface through a nozzle and the cleaning solution is recovered from the surface with suction and deposited into a recovery tank includes, according to the invention, the steps of admixing an oxidizing agent with the cleaning solution, and heating the admixture prior to the step of dispensing the cleaning solution onto the surface to be cleaned.
US07862621B2

The invention relates to a prosthetic device (30), in particular a foot prosthesis, for fitting leg amputees, with a universal joint mechanism (32), which couples a shaft (34) with a treading attachment (40, 42) through an articulation, wherein the universal joint mechanism (32) comprises a joint element (44) supported such that it is rotatable about a first rotational axis (C) and a second rotational axis (D) differing therefrom. For more accurate modeling of the natural gait of a healthy human foot, the invention provides that the universal joint mechanism (32) comprises a shaft-side joint fork (36) coupleable with the shaft (34) and a treading-side joint fork (38) coupled via the joint element (44) through an articulation with the shaft-side joint fork (36), wherein the shaft-side joint fork (36) is swivellable about the first rotational axis (C) and the treading-side joint fork (38) about the second rotational axis (D) relative to the joint element (44), and wherein the swivel movements of shaft-side and treading-side joint fork (36, 38) relative to the joint element (44) are carried out against the resistance of at least one damping element (90, 92) proximal to the joint element.
US07862620B2

Systems and method for monitoring gait dynamics are disclosed. The performance of an orthotic or prosthetic device or other device associated with a limb may be measured based on the resistance of a bending sensor. Data from the sensors is gathered or processed, particularly for purposes of alignment, safety, failure, usage, selection, and artificial proprioception. Information relating to the device may be outputted visually or auditorily to an individual.
US07862618B2

A vertebral implant for insertion into a patient includes first and second end members that include recesses for engaging a spacer member and a distractor. The end plates include a bone contact surface and an oppositely facing surface. A peripheral surface extends around a perimeter of the end members. The recesses may extend inward from the oppositely facing surfaces. Further, the recesses may extend inward from the peripheral surfaces. The recesses for engaging the spacer member and distractor may be separate from each other or may intersect one another. A spacer may engage the end plates to establish a desired vertebral spacing. The spacer may be positioned between the implants after a desired distraction is obtained with a distractor that engages the end plates.
US07862592B2

This invention relates generally to spine surgery and, in particular, to methods and apparatus for treating spinal stenosis.
US07862585B2

A device for use in tissue repair, a method of using the device in a surgical procedure and a method of making the device. The device is an assembly of a cannulated anchor with a cord passed through it, and a stopper to prevent the cord from passing back through the anchor.
US07862584B2

A suture lock to be used with a suture thread. The suture lock comprises at least one passageway for receiving a suture thread, with the passageway having at least a portion of its length having a longitudinal side opening arranged to slidably receive the suture. The passageway is tapered inwardly and including an interior surface having inwardly converging teeth. The invention may also comprise a suture lock having an adjustable channel located within the suture lock. The channel may be adjusted between an open and a closed position, thereby allowing the suture to be secured. Translation of the suture itself may be utilized to adjust the positioning of the channel. The suture lock may contain a releasable device to retain the channel in multiple positions between the closed and open position.
US07862577B2

A temporary filter is described for use in percutaneous intravascular procedures for the treatment of diseased blood vessels, such as angioplasty or stent placement procedures. The guide wire which is used to direct a catheter (such as a balloon catheter) to a treatment site contains a deployable filter. The guide wire is moveable independently of the catheter and can be used to position the filter at a desired location downstream of the treatment site. The guide wire includes parts moveable with respect to each other and the filter is connected to these parts in such a way that it can be deployed and collapsed by relative movement of the parts.
US07862573B2

A surgical fastener system includes a plurality of fasteners having a throughbore with an internally threaded portion. The fasteners may engage with a threaded mandrel that passes through the throughbore of the fasteners. A rotator may rotate the fasteners relative to the mandrel to move at least one of the fasteners along the mandrel, e.g., along the mandrel's longitudinal axis. A distal end of the mandrel may be inserted into a material, such as a tissue, prosthetic or other, and a fastener may be deployed from the distal end of the mandrel while the distal end is positioned in the material. The throughbore of the fasteners may include a threaded portion and an unthreaded portion, may include an angled face or other feature to aid in fastener deployment and/or have curved depressions in the head portion.
US07862571B2

An occlusion clip is disclosed that comprises an upper occlusion member having substantially parallel first and second upper occlusion arms each having proximal and distal upper occlusion arm ends. The first and second upper occlusion arms define an upper main body width dimension. An upper arcuate portion connects the first and second upper occlusion arms at their distal ends. The occlusion clip also comprises a lower occlusion member having substantially parallel first and second lower occlusion arms each having proximal and distal lower occlusion arm ends. The first and second lower occlusion arms define a lower main body width dimension. A lower arcuate portion connects the first and second lower occlusion arms at their distal ends. The occlusion clip further comprises a torsion spring connecting the proximal end of the first lower occlusion arm to the proximal end of the second upper occlusion arm. The torsion spring biases the upper and lower occlusion members toward a closed position wherein the upper occlusion member is in contact with the lower occlusion member.
US07862565B2

The invention is concerned with cauterizing and resecting tissue. A pair of electrodes are placed on opposed tissue surfaces, and radio frequency power is applied through the electrodes to cauterizing a tissue mass therebetween. After cauterization has been effected, the tissue may be resected along a plane within the cauterized region with minimum or no bleeding. The tissue mass may then be removed.
US07862564B2

A cosmetic method of regenerating the skin in the region of a stretch mark is disclosed. The method comprises operating a source of thermal energy with a low thermal time constant, and directing it at the surface of the skin adjacent to and within a stretch mark forming first and second adjacent regions of thermally-modified tissue. The first region is adjacent to, and overlies, the second region, and the first region is thermally modified to a greater extend than the second region such that, following treatment, the width of the stretch mark is reduced and the reticular architecture of the dermis in the stretch mark is at least partially restored.
US07862563B1

A method and apparatus for the application of an electrical signal to neural tissue and other target tissue in the living body.
US07862559B2

High-strength microwave antenna assemblies and methods of use are described herein. The microwave antenna has a radiating portion connected by a feedline to a power generating source, e.g., a generator. The antenna is a dipole antenna with the distal end of the radiating portion being tapered and terminating at a tip to allow for direct insertion into tissue. The antenna can be used individually or in combination with multiple antennas to create a combined ablation field. When multiple antennas are used, microwave energy can be applied simultaneously to all the antennas or sequentially between the antennas. Furthermore, to facilitate positioning the antennas in or near the tissue to be treated, RF energy may be applied at the tip of the antenna to assist in cutting through the tissue.
US07862558B2

Devices, systems, and methods treat cosmetic defects, and often apply cooling with at least one tissue-penetrating probe inserted through of the skin of a patient. The cooling may remodel one or more target tissue so as to effect a desired change in a composition of the target tissue and/or a change in its behavior. Exemplary embodiments of the cooling treatments will interfere with the nerve/muscle contractile function chain so as to mitigate wrinkles of the skin. Related treatments may be used therapeutically for treatment of back and other muscle spasms, chronic pain, and the like. Some embodiments may remodel subcutaneous adipose tissue so as to alter a shape or appearance of the skin surface.
US07862554B2

The invention provides surgical or diagnostic tools and associated methods that offer improved user control for operating remotely within regions of the body, and improved methods of assembling the tools. In some embodiments these tools include a proximally-located actuator for the operation of a distal end effector, as well as proximally-located actuators for articulational and rotational movements of the end effector. Control mechanisms and methods refine operator control of end effector actuation and of these articulational and rotational movements. The articulation mechanisms comprise pairs of links, one link distal and the other proximal, configured such that movement of a proximal link is transferred to the distal link by way of tension bearing members. Embodiments of the invention include a guide for such tension bearing members that facilitates assembly of the tool. Embodiments also include improved methods for attaching tension bearing members to the links. The inventions disclosed herein may also be used with articulating devices outside of the surgical and diagnostic fields.
US07862550B2

A mechanical fastening system for an article having a stretchable loop fastener component mountable on the article and including an elastomeric substrate and a high bond point non-woven loop material secured to the elastomeric substrate. The bond points on the non-woven loop material are defined by discrete compression points and the non-woven loop material is substantially free from discrete compression points other than at the bond points. A hook fastener component is mountable on the article and adapted for releasable engagement with the loop fastener component. The stretchable loop fastener component is stretchable relative to the hook fastener component when the fastener components are engaged.
US07862547B2

A medical needle shield apparatus is provided which includes an extensible shield having a first segment and a second segment extending therefrom. The second segment includes an opening configured for clearance of a medical needle of a medical needle device during attachment of the extensible shield to the medical needle device. The second segment defines a planar surface adjacent a distal portion thereof. The planar surface is configured to engage the needle for disposing the shield in an extended position. In alternate embodiment, the medical needle shield apparatus has a syringe having a needle hub supporting a needle. The first segment articulates from a collar disposed about the needle hub. The collar includes a pair of latches. The opening is configured for travel about the needle to facilitate extension of the shield from a retracted position to an extended position. The second segment further includes a proximal fulcrum that engages the needle to facilitate extension of the shield. The second segment also has a pair of catches. The catches are engageable with the latches to maintain the shield in the retracted position. The second segment has a nose portion defining a planar surface configured to engage the needle to facilitate fixing the shield in the extended position.
US07862538B2

Described herein are systems for packaging dual or multiple-component adhesive systems that provide enhanced convenience and efficacy. In one aspect, the components of such a system may be divided into containers that allow for foolproof mixing schemes to avoid mixing the wrong components while also providing a sterile surface for mixing materials, with the sterile surface having optimal physical properties for mixing the materials, especially in small amounts. Certain embodiments include a surgical delivery system for a medical sealant including a packaging system with a detachable a sterile surface for mixing the sealant as needed for application.
US07862532B2

A punctum plug comprises a distal tip for anchoring the punctum plug in an implanted position in the lacrimal drainage system of the eye, a proximal cap that remains exposed in the eye in the implanted position, and a body connecting the distal tip to the cap. The distal tip includes a plurality of longitudinal depressions along its outer surface to facilitate implantation, and one or more strengthening beams to resist deformation or collapse of the punctum plug.
US07862531B2

A flow regulating implant is provided with one or more grooves for allowing fluid flow. One or more grooves may have a constant or varying cross-section along its length. One or more grooves may have in it biodegradable material, absorbable material, and/or threads or sutures. A resilient band or coating may be placed around the implant or one or more grooves, to act as a pressure regulator. The implant may have a side projection, such as a side pin, for engaging tissue. The implant may comprise two or more parts that are held at a distance from each other to allow fluid flow between the parts.
US07862530B2

The dose of dialysis in terms of urea clearance is marginal in many hemodialysis patients, and metabolic acidosis as determined by the pre-dialysis serum HCO3 level is common. A dialysate that included citric acid rather than acetic acid as acidifying agent provides superior performance properties. Citrate-containing dialysate was used exclusively in 22 hemodialysis patients. Initially, only 8 of the 22 patients had a pre-dialysis serum HCO3>23 mEq/L (lower limit of normal), however, after 12 weeks of dialysis using the citrate-containing dialysate, the serum HCO3 normalized in 15 patients (p=0.0001, Chi-square). Dialysis variables were kept constant in 19 of the patients, who also used and reused the same dialyzer model throughout. In these patients, the initial average urea reduction ratio (URR) was 68.5±5.9%, and after treatment with the citrate dialysate disclosed herein, this ratio had increased to 73±5.3% (p<0.03). SpKt/V, calculated using the Daugirdas II formula, also increased from 1.23±0.19 to 1.34±0.2 (p=0.01). This increased urea clearance may be the result of the anticoagulant property of citrate maintaining patency of the dialyzer membrane. The increase in pre-dialysis serum HCO3 may represent increased delivery from the dialysate and production from citric acid.
US07862526B1

A cervical traction assembly whereby the user can exert a variable load on the cervical spine and receive a sensory feedback when the traction is at or within range of a target load. The assembly includes a head harness wrapped around the forehead of the user that is attached to a traction bar connected to a load line assembly that passes through a direction reversal pulley and terminates with force straps actuated by the user's legs. The load line assembly includes a spring force scale that includes a control assembly that allows the user to set a target applied load and receive sensory feedback in the form of varying audible signals as the user applied load approaches, meets and exceeds a target load range.
US07862523B2

The invention relates to a force or pressure sensor and a method for applying the same. The pressure sensor includes a substantially rigid, mechanical-load resistant frame, a flexible diaphragm secured over its peripheral rim to the frame, and a piezoelectric sensor diaphragm applied to the surface of the flexible diaphragm. The sensor diaphragm loading element comprises a substantially rigid, mechanical-load resistant cover, having its protrusion or shoulder bearing against a middle section of the flexible diaphragm and thereby prestressing the flexible diaphragm and the piezoelectric sensor diaphragm attached thereto. The frame and the cover define therebetween a closed, hermetically sealed housing chamber, the flexible diaphragm and the piezoelectric sensor diaphragm located thereinside. The placement of one or more responsive, yet load-resistant sensors in contact with a bed enables measuring a sleeping or lying person for his or her heart rate and respiratory amplitude, as well as frequency.
US07862517B2

A localization mechanism, or fixture, is used in conjunction with a breast coil for breast compression and for guiding a core biopsy instrument during prone biopsy procedures in both open and closed Magnetic Resonance Imaging (MRI) machines. The localization fixture includes a three-dimensional Cartesian positionable guide for supporting and orienting an MRI-compatible biopsy instrument, and in particular a sleeve, to a biopsy site of suspicious tissues or lesions. A depth stop enhances accurate insertion, and prevents over-insertion or inadvertent retraction of the sleeve. The sleeve receives a probe of the MRI-compatible biopsy instrument and may contain various features to enhance its imagability, to enhance vacuum and pressure assist therethrough, and marker deployment etc.
US07862510B2

An apparatus and method for the assessment of various properties of bone is provided. A pair of ultrasound transducers are applied to skin on opposite sides of a bony member. The transducers may be single-element or array transducers. An ultrasound signal is generated and directed through the bony member to obtain a bone output signal. A set of parameters associated with the bone output signal is established and processed to obtain the desired bone property including two net time delay (NTD) parameters indicative of differences in transit time for signals taking different paths through bone and soft tissue. Also disclosed is a novel means for acoustically coupling the transducers to skin, as well as a means for establishing bone mineralization through use of both ultrasound and x-ray measurements.
US07862506B2

A diabetes management system, comprising a glucose meter measuring blood glucose level data and a portable microprocessor-based unit in communication with the blood glucose meter such as to be capable of accessing the blood glucose level data. Input data corresponding to the blood glucose level data is used in a program of instructions running on the portable microprocessor-based unit or the glucose meter, or both. The program of instructions includes instructions to communicate a signal to inject insulin based upon the blood glucose level data.
US07862498B2

Apparatus for delivering brachytherapy to a target tissue region includes an elongate body including a proximal end, a distal end sized for introduction into a tissue tract and carrying a plurality of elongate members including pathways for receiving a source of radiation. The elongate members are movable between collapsed and expanded configurations. During use, a tract is created through tissue, and the elongate body carrying the elongate members is advanced through the tract into a target location with the elongate members in the collapsed configuration. The elongate members are directed to the expanded configuration at the target location, and radiation is delivered to treat tissue at the target location, e.g., by introducing one or more radiation sources along the pathways. The apparatus may include features to prevent overexpansion of the elongate members and/or to facilitate rapid collapse of the elongate members.
US07862497B2

A brachytherapy device may include a plurality of rods, each configured to move between a straightened position and a bowed position, the plurality of rods configured to collectively form a shaft while each rod is in the straightened position and to collectively form at least one cage while at least some of the rods are in the bowed position, at least some of the rods having lumens that are configured to receive and hold radioactive material. A brachytherapy device may further include a rotatable mechanism configured to cause at least some of the plurality of rods to move between the straightened position and the bowed position upon rotation of the rotatable mechanism.
US07862492B2

A roller for a web-processing machine has a support core, which is braced in the region of both its ends via a respective bearing arrangement, and an outer covering, which in its axially central region is braced in a radially fixed manner in relation to the support core and in the region of its two ends is braced in a radially displaceable manner in relation to the support core by a respective additional bearing arrangement, whereby the radially extending center plane of both the support core bearing arrangement and the outer covering bearing arrangement lies axially within the outer covering, and the outer covering is displaceable in the region of its two ends respectively by an actuator arranged preferably within the outer covering.
US07862480B2

A safety mat securement assembly for providing open and a closed position for a climbing wall assembly using a safety mat. The safety mat securement assembly utilizes a plurality of security hand hold members each having latching means and a safety mat having a plurality of bottom securement members, top and side loop members. The security hand hold members may be used as hand holds on the climbing wall assembly and may have a locking structure. The bottom securement members function to hold the safety mat to the bottom of a climbing wall assembly during both open and closed positions of the safety mat. The mat securement assembly is opened or unlocked by loosening the latching means, removing security mat top loop members from the hand hold, and placing the mats on the floor along the base of the climbing wall. When in closed or locked position, the security mats may contain a printed message communicating that the climbing wall is closed and climbing should not take place. A cover member may be provided to further secure the climbing wall.
US07862475B2

An exercise device configured to sense and respond to objects in proximity to the exercise device is provided. The device includes a sensor configured to sense objects in proximity to the exercise device other than the user who is operating the exercise device. A console is in communication with the sensor that instructs components of the treadmill to provide, for example, an audible and/or visual response to the user of the exercise device, or to slow or stop the exercise device from moving. Sensors that are capable of sensing whether objects are within different spatial zones of proximity are disclosed. Multiple pre-defined and/or user-defined responses to objects detected in multiple corresponding spatial zones of proximity are also disclosed herein.
US07862469B2

A method for controlling a drivetrain of a motor vehicle is provided. The drivetrain includes, as components, at least an internal combustion engine, an electric drive machine, a clutch and a transmission that can be connected to drive wheels. A control device initiates gear shifts at the transmission based on a wide variety of sensor signals by using a characteristic diagram. In order to ensure an excellent shift quality over long operating periods, a drive torque value MV of the internal combustion engine, which is determined by the control device, can be checked and if necessary corrected in dependence of given conditions by determining the drive torque value ME of the electric drive machine.
US07862461B2

An automatic transmission that includes one clutch that includes a clutch drum; a piston that forms a hydraulic oil chamber using a part of the clutch drum as a cylinder; a plurality of friction plates that engage with the clutch drum; and a cancel oil chamber that is provided on a rear side of the piston and that cancels a centrifugal oil pressure that acts on the hydraulic oil chamber. Oil is supplied to the cancel oil chamber from a boss portion formed in the clutch drum on a radially inner side, and the oil is discharged from discharge holes formed in the boss portion to an outside of a hydraulic oil chamber side of the clutch drum.
US07862448B2

It is a sport equipment 2 using a partially hardened sheet form prepreg 10 formed by impregnating a reinforced fiber material 6 disposed substantially parallel with a thermal hardening resin material 7 to bind the reinforced fiber material, where the prepreg is layered so as to form a tube rod in a tapered shape having a diameter increasing from one end to the other, and the tube rod is provided with a strengthening means on a radially entire circumference to the axis direction. Herewith it is especially used for a golf club shaft, while maintaining a characteristic of light weight, securing strength equal to or greater than a steel-made golf shaft, and suppressing unnecessary deflection and vibration, so as to provide a sports equipment made of a reinforced fiber combined material such as a gold club shaft having high strength such as bending and twisting rigidity.
US07862447B2

A golf club shaft is provided that has a grip end opposite a head end and defining a length of the shaft extending between those two ends. The shaft has a tubular cross-section over at least one portion of the shaft length which cross-section has a substantially circular outer periphery and a polygon inner periphery formed of a plurality of between 4 and 24 flats, and preferably formed of 8-16 flats. A mandrel having the shape of the inner periphery of the shaft is also provided, as is a method of forming the shaft that uses the mandrel and composite matrix materials.
US07862445B2

The disclosure herein includes a grip for a golf club with a flexible tube and a layered sheet. The tube includes a tubular body and raised portions extending from the tubular body. The outer surface of the raised portions cooperates with the layered sheet to form a gripping surface. The grip reduces impact shock and provides a feeling of tackiness while providing increased variation in the physical characteristics of the gripping surface.
US07862430B2

A gaming system including a central server linked to a plurality of gaming machines. In one embodiment, the gaming system provides players with one or more loyalty incentives, such as one or more loyalty awards, utilizing one or more loyalty incentive award sequences. In one embodiment, the gaming system determines a loyalty award to provide to a player and then determines an appropriate loyalty award sequence to utilize to provide the player the determined loyalty award, wherein the loyalty award sequence is determined based on the individual gaming device that the player is currently playing.
US07862428B2

An action figure is provided with a serial number that provides an access code which allows owners to engage in enjoyable games or other activities via the Internet or other gaming systems. The interactive action figure system comprises a toy, statue, or other three-dimensional figurine with a serial number, and preferably a computer network accessible over the internet and a particular gaming framework managed by a network device. Owners of action figure toys may “log onto” the network using the action figure serial number as an access code to activate a particular computer character identity and participate in games such as hand-to-hand combat games, action-adventure series, or learning games. The action figure may be, for example, a warrior, sports figure, doll or teddy bear to appeal to a wide range of users. Once a particular character is activated, game play proceeds according to preset rules. The game character's traits, powers, and other features may be enhanced or otherwise modified by purchasing preferably-three-dimensional accessories and inputting serial numbers into the gaming system that are also supplied with the accessories.
US07862424B2

The present invention is directed generally to a method and apparatus for operating a gaming device having a flat rate play session costing a flat rate price. The flat rate play session spans multiple plays on the gaming device over a pre-established duration. The gaming device identifies price parameters and determines the flat rate price of playing the gaming device based on those price parameters. In one embodiment, identifying price parameters includes receiving player selected price parameters. In another embodiment, price parameters further incorporate operator selected price parameters. Should the player decide to pay the flat rate price, the player simply deposits the necessary funds into the gaming device or makes a credit account available for the gaming device to debit. Once the player initiates play, the gaming device tracks the duration remaining in the flat rate play session and stops the play when the given period has elapsed. During the play, payouts are made either directly to the player in the form of coins or indirectly in the form of credits to the player's credit account.
US07862422B2

A gaming device including a display device that rotates a co-acting symbol display about a horizontal and vertical axis to display at least one symbol to a player. The symbol display is movably connected to a support and includes a first symbol display and a second symbol display. The first symbol display includes a first wheel and a first reel and the second symbol display includes a second wheel and a second reel. Each of the first and second wheels and reels display a plurality of symbols to the player. A processor causes the symbol display to move to one or more different positions and in one or more different directions to display one or more symbols to a player based on game play, a game function or a game mode in a game displayed by the gaming device.
US07862419B2

A processor controlled gaming device that randomly generates and displays a pachinko-type game and outcome on a screen connected to the processor. The gaming device initially provides a preliminary game that yields the number of attempts or objects that the player has in the pachinko-type game. Next, the game displays the pachinko-type game screen having a player selectable starting area. The starting area is large enough so that when the player picks a certain position of the area, the object falls from the selected position, hits a plurality of pegs and lands in an award position. The selected start position affects which award position that object eventually falls in accordance with the probability distribution predicted by the laws of physics. The player's award, however, is not affected by which start position the player selects.
US07862415B1

An electronic game, method and apparatus, is disclosed which includes a playfield that is subdivided into a plurality of sectors. Each sector includes one or a plurality of playing positions, and each playing position has an indicator. The device incorporates a plurality of rotation patterns, each of which maps a plurality of indicators on the playfield. The device further incorporates a plurality of indicating states that correspond to a plurality of visual indications. In addition, the device includes a plurality of input control mechanisms to enable a player to activate the rotation patterns. The object of the game is for the player to manipulate the switches in order to transform an initial pattern of visual indications to a desired pattern of visual indications. The device functions by rotating the indicating states between the various sectors on the playfield using predefined rotation patterns. As an indicating state is shifted, or rotated, from one sector to another, it provides a different visual indication. The device employs a microprocessor to control the progress of the game, monitor the activation of the input switches, rotate the indicating states between indicators defined by a rotation pattern, and generate visual indications based on the configuration of indicating states and sectors. The microprocessor also controls the generation of audio/visual effects to enhance the enjoyment of play. Further, the device employs means to generate a plurality of puzzles, and games, and provisions to vary the level of difficulty of play.
US07862413B2

A remotely positionable interruption plate system for altering chop quality in a chopper assembly. The system includes a base and an interruption plate slidably mounted to the base. The interruption plate is arranged and disposed to selectively position the interruption plate into at least a portion of a residue flow of the chopper assembly. The selective positioning of the interruption plate is accomplished remotely. An agricultural vehicle and a method utilizing the remotely positionable interruption plate system are also disclosed.
US07862411B1

A cob collection device for use with a corn harvester, includes a conveyor system including a portion for positively removing or cleaning attached husks from the cobs after removal of corn therefrom by the harvester, the conveyor system including an upwardly inclined conveyor portion operably movable in cooperation with the collection device for distributing delivery of cobs thereto, the cob collection device having a wall portion including an aperture for receiving the inclined conveyor portion, and a door for closing the aperture when the conveyor is removed, allowing unloading of the collection device, and stowage of the conveyor in a compacted manner to facilitate travel under bridges, utility wires, doorways and the like.
US07862403B2

A surface grinder for a ball of a ball valve comprises a ball positioning device at an X axis for driving the ball to rotate about the X axis and a grinding device at a Z axis for driving a grindstone set to rotate about the Z axis, wherein the grindstone set grinds a spherical surface of the ball.
US07862398B2

A robot toy including one block to which a servo is installed, another block joined to the one block by fitting an output shaft of the servo to a shaft hole, and a shaft hole diameter adjustment member to change a diameter of the shaft hole so as to be in a condition where the shaft hole is loosely fitted to the output shaft or a condition where the shaft hole is tightly fitted to the output shaft.
US07862394B2

Apparatus includes a buoyant structure having a central vertical axis when floating in water and having at least one feature to reduce a rotation of the buoyant structure about the central vertical axis when floating in the water. The apparatus further includes an electronic camera assembly coupled to the buoyant structure. The electronic camera assembly is configured to generate an electronic image signal. The apparatus further includes a tubular structure coupled to the buoyant structure and configured to remain under the surface of the water. The tubular structure includes a watertight compartment and an electronic circuit assembly disposed within the watertight compartment. The electronic circuit assembly is coupled to receive the electronic image signal and is configured to generate an optical image signal representative of the electronic image signal. The apparatus further includes a fiber optic cable configured to carry the optical image signal.
US07862392B1

A sleeve-type wire connector comprises: a first tube having a first opening end and a connecting end, with a first guiding surface in the first opening end that can retract toward the connecting end thereof; a copper sleeve in the connecting end of the first tube; and a second tube having a connecting end corresponding to the connecting end of the first tube and a second opening end, with a second guiding surface in the second opening end that can retract toward the connecting end thereof.
US07862388B2

The invention relates to a connector block for separating a plurality of insulated conductors of an electronic data cable, said connector block containing: a plurality of slits arranged in a row along a common side of the connector block; a plurality of insulation displacement contacts comprising forked contact sections which at least partially extend into respective individual slits in order to electrically separate the insulated conductors; and a cable manager which is coupled to another side of the connector block and extends outwardly therefrom. The cable manager is embodied in such a way as to secure the conductors in substantially fixed positions between one end of the sheath of the data cable and the insulation displacement contacts.
US07862385B2

An electrical, circuit breaker protected, extension cord in-line tap, securement device for securing tandemly connected electrical extension cords. The securement device includes opposing proximal and distal open-ended eyelets each having a hinged locking flap for receiving therein a looped end of the associated extension cord thereby preventing unintended separation of the extension cords. The in-line tap further includes a pair of circuit breaker protected auxiliary electrical outlets on opposing sides for powering additional extension cords.
US07862384B2

A device and method for repairing a failed modular connector having a broken locking tab by providing an adapter which receives the broken modular connector and includes a mechanism for retaining the broken modular connector, which may include a retaining clip, retaining barbs, or teeth, tight friction, friction bumps, adhesive or other retaining device. The adapter mechanically and electrically connects to the broken connector and provides a straight through wired modular plug with a retaining clip so that the assembly comprising the broken connector and adapter may plug into a jack for the original broken connector and be securely retained.
US07862383B2

An electrical connector includes a rigid body, cable mating bodies disposed within the body, and contacts joined to the cable mating bodies. The body has an upper side and an opposite mounting side that is configured to be mounted to a first solar module. The body frames a window that extends through the body from the upper side to the mounting side. The cable mating bodies are configured to electrically couple the first solar module with cables to communicate electric current generated in the first solar module with one or more of an electrical load and an additional solar module. The contacts extend into the window of the body and are arranged in the window to mate with the module contacts to electrically couple the first solar module with the cable mating bodies.
US07862378B1

A vertical socket connector has an insulating housing, an insulating bracket, multiple first terminals, multiple second terminals and a shell. The insulating bracket is mounted on the insulating housing. The first terminals are mounted on the insulating housing. The second terminals are mounted on the insulating bracket. The shell covers the insulating housing, insulating bracket and terminals and forms a socket hole. Soldering sections of the first and second terminals protrude horizontally backward through rears of the insulating housing and insulating bracket so that the vertical socket connector is mounted vertically on a PCB with the socket hole opposite to the PCB.
US07862362B2

The invention relates to a test holder for fixing the position of a microchip in a microchip contactor, having a base frame and a pressing unit, which is connected to the base frame such that it can be pivoted open or shut and which comprises a pressure body designed to interact with the microchip. In order to press the microchip all over with a uniform pressure onto the contactor, even if the microchip is inclined with respect to the pressing means when it is contacted with the contactor, the invention provides that the pressure body may be tilted about a first and a second tilting axis.
US07862335B2

A dental tartar detection system (10), especially for detection of subgingival tartar (S), comprises a probe (12) adapted to be displaced along a tooth (T), an illumination system (14) for illuminating with an incident light a region on the tooth (T), a detection system (16) for collecting the light reflected thereat, and an analysis system (34) for providing a signal to an operator of the probe (12) when measurements on the reflected light in one or more predetermined range of wavelengths fall within any predetermined range of values that are characteristic of tartar (S). Typically, the detection of tartar (S) is achieved on the basis of the possible colors that tartar (S) can have such that the aforementioned one or more predetermined range of values cover wavelengths associated with colors of tartar (S).
US07862333B2

In order to provide, for a grate cooler for cooling hot bulk material, such as, for example, cement clinker, an, in particular, automatically operating cooling air regulator which has a simple construction and can be used without difficulty both for unmoved and, in particular, for moved cooling grate regions or moved cooling grate systems, for example, cylindrical hose sleeve comprised of elastic material be tension-mounted as an actuating member coaxially in the regulator housing which is arranged below the cooling grate, participates in the movements of the latter and has a casing comprised of solid material, the pressure difference inside and outside the hose sleeve and the deformation resistance of the sleeve being set such that the hose sleeve is deformable, in particular, automatically from its maximum flow cross section into its minimum flow cross section and at the same time regulates the volume flow of the cooling air flow from below into the cooling grate.
US07862331B2

The present invention comprises a device which utilizes catalytic microcombustion for the production of heat or power and which exhibits a low pressure drop and has a high catalytic surface area. The catalytic microcombustor includes catalyst inserts in the reaction chamber separated by a sub millimeter distance. Thermal spreaders ensure temperature uniformity and maximum thermal efficiency. A mixing zone is prior to the combustion zone. Thermally conductive and/or insulating inserts are in the vicinity of the reaction zone.
US07862317B2

A mold includes at least one axial member carrying at least one sidewall molding surface for molding a sidewall of a tire, radial segments each carrying at least one surface for molding a tread of the tire and locking surfaces for connecting the axial member with the radial segments. First radial and axial locking surfaces which are displaceable and carried by the axial member cooperate with second radial and axial locking surfaces. The sidewall molding surface is integral with a fixed portion of the axial member. The first radial and axial locking surfaces are integral with at least one locking member mounted in the axial member and are movable relative to the fixed portion.
US07862309B2

A thin fan structure is composed of a driving unit and a rotating unit. The driving unit has a base, a coil circuit board and a shaft, in which the coil circuit board is disposed at the base. The rotating unit has a bearing, a fan blade, an iron-containing metal sheet and a magnet, in which the bearing has an outer ring and an inner ring. The fan blade, the iron-containing metal sheet and the magnet are fixed at the outer ring of the bearing, the inner ring of the bearing is fixed at the shaft of the driving unit and the coil circuit board of the driving unit is able to drive the rotating unit turning around.
US07862303B2

A single stage high pressure turbine vane includes an airfoil having a profile substantially in accordance with at least an intermediate portion of the Cartesian coordinate values of X, Y and Z set forth in Table 2. The X and Y values are distances, which when smoothly connected by an appropriate continuing curve, define airfoil profile sections at each distance Z. The profile sections at each distance Z are joined smoothly to one another to form a complete airfoil shape.
US07862294B2

The invention relates to a segmented inner ring for holding guide blades. According to the invention, a lateral wall opposing the front side of the inner ring and pertaining to a shaft shoulder formed on the rotor shaft extends radially, and respectively one half of a labyrinth seal is formed on the front side of the inner ring and on the shaft shoulder. The aim of the invention is to apply an arrangement of stacked labyrinth seals, known from aeroplane turbines, to a stationary gas turbine having a separation plane. To this end, a method is used to mount an inner ring of a gas turbine. The invention also relates to a stationary gas turbine comprising a segmented inner ring.
US07862293B2

A bleed air cooler assembly of a gas turbine engine comprises a cooler body defining a fluid passage therein and a connector detachably affixed with the cooler body installed in an annular bypass air passage.
US07862287B2

A multi-motion lifting and transferring apparatus and method are disclosed. The multi-motion lifting and transferring apparatus and method may be realized in primarily two versions, the first being referred to as the single linkage arm version, and the second being referred to as the dual linkage arm version. In one particular exemplary embodiment, a multi-motion lifting and transferring apparatus in accordance with the single linkage arm version may be realized as having a first pivot point for rotating an intermediary support member about a first substantially vertical axis, a second pivot point for rotating an electrically or hydraulically powered up/down extension arm about a second substantially vertical axis, and a seat support member for supporting a seat for accommodating at least one person.
US07862280B2

A saw tooth screw provides a screw thread divided into a first and a second thread sections. A plurality of slots, inclined with respect to a shank axial line, are disposed on each thread of the first thread section for dividing the thread into a plurality of thread segments, wherein each of the thread segment has a first inclined surface and a second inclined surface on two ends thereof; the first inclined surface is parallel to the second inclined surface. The thread of the second thread section is formed of a saw-tooth-shape by having recesses extending from a shank to an outer edge of the thread for debris of object to exit through the slots, thereby reducing the screwing torsion and increasing the screwing rotation speed.
US07862270B1

A method and apparatus for restraining cargo in a trailer is provided. The apparatus has four components: a mobile cargo stop, a chain, means for anchoring the chain to the trailer floor near the trailer front wall, and a front wall liner mounted to the trailer front wall. The chain runs from the anchoring means near the trailer front wall, under the cargo, and is affixed to the cargo stop with a turnbuckle hook. The cargo is restrained between the front wall liner and the cargo stop by tightening the chain using a cinching device mounted on the cargo stop.
US07862264B2

A method for forming an opening in two different turbine components is provided. The method includes coupling a clamp to a base and coupling the clamp to a clamp bar, wherein the clamp bar is moveable with respect to the base. A first bushing plate is selected based on a first turbine component being drilled and is removably coupled to the base. A bushing is removably coupled to at least one aperture extending through the first bushing plate. An opening is formed in the first turbine component. A second bushing plate is selected based on a second turbine component being drilled. The second turbine component is different from the first turbine component. The second bushing plate is removably coupled to the base. An opening is formed in the second turbine component.
US07862261B2

A tool holder for a resharpenable cutting tool insert has a body portion which includes a recess. A wedge member is positioned in the recess. A locking screw locks the wedge member such that the top surface of the wedge member is in engagement with the bottom surface of the insert and the locking screw is threadably connected to the body portion and to the wedge member so that the cutting tool insert may be removed for sharpening and re-inserted at the same location relative to the tool holder.
US07862255B2

A marine pipelaying system and method for installing an offshore pipeline that includes one or more accessories. The system comprises a vessel (1), a pipeline launch device (10) for launching the pipeline (2) from the vessel in the direction of the seabed, and a clamping device (30) adapted to support the weight of the previously launched pipeline. The system further includes an accessory handling device, which is adapted to receive and support an accessory (40) and allow displacement thereof between an receiving position, wherein the accessory is received by the handling device and a pipeline connecting position, wherein the accessory can be connected to the pipeline (2).
US07862254B2

Disclosed are an even-irrigation apparatus for an underground root zone and an even-irrigation method using the same for evenly supplying water into the root zone of a variety of crops. The even-irrigation apparatus includes a plurality of irrigators buried in the entire underground root zone, to directly and evenly supply water into the root zone. Once water is introduced into a pressure-reduction valve after passing through a main pipe, limb pipe and capillary pipe connected in sequence, the water is supplied to the irrigators by way of a plurality of diverged-capillary pipes. With this even-irrigation of water, unnecessary consumption of water due to adsorption of the water into the surrounding soil except for the root zone is minimized, enabling effective irrigation of water and even growth of roots of crops. Further, even nutrition throughout the roots enables balanced growth of crops.
US07862252B2

A vehicle barrier system. The vehicle barrier system includes a base, an arm hingably mechanically coupled to the base, a raising/lowering mechanism in mechanical communication with the arm, and a cable supported by the arm, the cable mechanically coupled to first and second anchors placed on opposite sides of an area through which a vehicle may pass, and the raising/lowering mechanism moves the arm and the cable between a first position and a second position.
US07862243B2

Device for the coaxial connection of fiber-optic cables, comprising a single-piece coupling housing (10) and a single-piece sleeve mount (20), the sleeve mount (20) being designed with at least one latching nose (21) and the coupling housing (10) being designed with at least one latching mount which complements the at least one latching nose (21), wherein the latching mount is designed with at least one latching hook (14) and at least one stop (15).
US07862242B2

A vehicle wheel bearing apparatus has an outer member formed, on its inner circumference, with double row outer raceway surfaces. An inner member is formed on its outer circumference surface, with double row inner raceway surfaces arranged opposite to the double row outer raceway surfaces. Double ball groups are freely rollably contained between the outer raceway surfaces and inner raceway surfaces, respectively, of the outer member and the inner member. It is formed as a double row angular contact ball bearing of back-to-back duplex type where a predetermined contacting angle is applied to each ball. A pitch circle diameter of the outer-side ball group is larger than a pitch circle diameter of the inner-side ball group. The outer-side groove diameter of curvature ratios are smaller than inner-side groove diameter of curvature ratios.
US07862241B2

A rolling bearing apparatus includes inner rings, an outer ring, and sealing devices each having a seal case fixed to the outer ring. The seal case includes a fixing portion press-fitted in the outer ring, and a ring-shaped portion extending radially inwardly from an axially-outer end of the fixing portion. The fixing portion has a ridge formed on and projecting radially outwardly from an outer peripheral surface thereof. The ridge is disposed nearer to the axially-outer end of the fixing portion than an axially inner end of the fixing portion.
US07862239B2

A tilting pad thrust bearing is described including a substantially solid flat carrier body, a plurality of bearing pads, and an intermediate component which is disposed in the assembled bearing between the bearing pads and the carrier body, the intermediate component providing a plurality of fulcrum means corresponding in number to the bearing pads and being angularly orientated such that the fulcrum means are disposed beneath the bearing pads. The arrangement is designed such that the intermediate component includes at least one of an annular hub portion and an annular rim portion from which a plurality of ribs project outwardly or inwardly thereof and on which individual bearing pads are arranged to be seated to pivot thereon, the ribs thus providing the fulcrum means, and in that a locating component is provided which also includes at least one of a hub portion and a rim portion.
US07862236B2

A circumrotating circulating guiding assembly of a linear sliding rail includes a sliding base body, a plurality of guiding assembly and a plurality of rolling elements. The sliding base body has a plurality of engaging portions and a plurality of guiding holes. The sliding base body is provided longitudinally with engaging portions. The guiding assembly comprises two circumrotating guiding portions, a plurality of fixing portions, a spacer and a plurality of guiding tubes. The fixing piece is fixed to the engaging portion. The guiding portion is combined with the circumrotating guiding portion. The rolling element is provided on the circumrotating circulating path in a rolling manner. With the fixing pieces being fixed to the engaging portion, and the spacer being engaged in the recessed portion, the insufficient strength of the guiding assembly formed of plastic materials can be compensated, thereby avoiding the vibration, noise and excessive frictional resistance efficiently.
US07862231B2

An apparatus for testing temperature includes a plurality of thermocouples, a plurality of relays, a ground circuit, a compensation circuit, a power supply circuit, a switch circuit, and an MPU. The thermo-couples samples temperatures at different locations in a CNC machine, each thermo-couple is connected to a corresponding relay and selectively connected to the switch circuit by turning on or off the corresponding relay, the compensation circuit includes a cold junction compensator and a first relay, the ground circuit includes a ground terminal and a second relay, the power circuit includes a power supply and a third relay. The first, second, and third relays selectively turn on or off to connect the cold junction compensator, the ground terminal, or the power supply to the switch circuit. The switch circuit includes a capacitor and a fourth relay, the fourth relay is selectively connected the MPU, the ground circuit, the compensation circuit, or the power supply circuit to the capacitor, the MPU obtains voltage at the capacitor, and converting the voltage to a temperature signal.
US07862226B2

The dial (4) of the watch is fitted with an indicator (10), preferably with a hand (11), which displays the function fulfilled by a control crown (8), respectively, in each axial position of the crown, including a highly water resistant position in the case of a screwed-in crown. The indicator is controlled by axial movements of a sleeve (15) secured to the crown, via a transmission mechanism (30) including a slide block (35) that is mobile parallel to an axis of rotation (14) of the crown. The hand is secured to a pinion (32) meshed with a rack (34) arranged on a slide block. The slide block includes a flexible part (38) between a back part that slides in a groove (36), and a front arm (39) provided with a lateral finger (40) engaged in an annular groove of the sleeve. This transmission is compact and facilitates assembly and removal.
US07862221B2

An optical lens refracts and reflects a light to increase a luminance in a top direction of the optical lens and to decrease a luminance in a horizontal direction of the optical lens. The optical lens includes a central portion and a peripheral portion. The central portion has a convex shape. The peripheral portion has a concave shape. The peripheral portion surrounds the central portion. Therefore, a power consumption and a manufacturing cost are decreased.
US07862207B2

Systems and methods are provided for imaging a planar specular object such as a semiconductor wafer. In one embodiment, an imaging system for imaging a defect on a planar specular object includes a telecentric lens having a sufficiently aspherical surface such that the telecentric lens is substantially corrected for an optical aberration. The imaging system also includes a telecentric stop including an aperture therein to block light reflected from the planar specular object while allowing light reflected from the defect to pass through the aperture. The imaging system further includes a lens group having a system stop positioned between the telecentric stop and the lens group. The lens group is substantially corrected for the optical aberration independent of the telecentric lens.
US07862196B1

A lighting system for illuminating a deck area. The wiring for the lighting system may be hidden from view, providing a more aesthetically pleasing appearance. Furthermore, the lighting system may be installed simultaneously with the deck itself, or afterwards. Embodiments of the present invention include baluster lights which may be mounted between the railing balusters and also mounted to the sides of posts. Embodiments of the present invention also protect the lighting system from environmental damage.
US07862195B2

An integrated and modular lighting system is disclosed. The lighting system includes a plurality of modules, each module including at least two echelons of light emitting diodes and a power supply on a common substrate. The modular lighting system is used to provide uniform illumination of an enclosed display stand.
US07862191B2

A lamp socket includes a socket housing and a power supply member. The socket housing has a connecting hole. The power supply member includes a first lamp and a second lamp connecting terminal. The first lamp connecting terminal is inserted into the connecting hole, and includes a securing member for preventing a lamp from secession from the lamp socket. The second lamp connecting terminal is inserted into the connecting hole, and includes securing member opening inserted by the securing member. Therefore, the number of elements may be decreased and the stability of lamp socket may be increased.
US07862182B2

Optical system for a projector, comprising: at least a first polarizing beam splitter for splitting a source illumination beam into a first illumination beam linearly polarized along a first direction and a second illumination beam polarized perpendicular to the first direction; at least one color wheel intersecting the polarized illumination beams in two different regions and producing a first color beam linearly polarized along the first direction and a perpendicularly polarized second color beam; and two imagers illuminated by the first and second polarized color beams respectively.
US07862181B2

A projection apparatus having a temperature controlling system is provided. The projection apparatus comprises at least a heat generating element, while the temperature controlling system comprises a liquid flow system, a heat generating device, and a heat transferring device. The liquid flow system is disposed along the heat generating element. The heat generating device produces heat with a positive value (endothermic) or a negative value (exothermic) in response to an environment dependent on the location of the projection apparatus. The heat transferring device transfers the heat generated by the heat generating device along the liquid flow system. The present invention maintains the operation of the projection apparatus under the desired working temperature and enables a thermal equilibrium of the projection apparatus without being influenced by the over-temperature or under-temperature of the external environment.
US07862180B2

The invention provides an optical system for image projection, wherein when used in an image projection apparatus, a screen-continuing portion (e.g., screen-underlying portion) of the apparatus can be reduced to a small size, or can be removed, and thereby the apparatus can be so compacted, and provides an image projection apparatus mounting such optical system. An optical system 10 for image projection including a lighting optical system 1 leading light from a light source 11 for lighting a display element 4 (or 4′), and a projecting optical system 3 for projecting projection light containing image information from the display element 4 (or 4′). The lighting optical system 1 is arranged such that a straight optical axis α from the light source 11 in the lighting optical system 1 is positioned in an area deviated from a luminous flux β of the projection light incident into the projecting optical system 3 toward an area where the projection light γ from the projecting optical system 3 passes. The image projection apparatus A (or B or C) mounting such optical system 10.
US07862179B2

A dual-mode projection apparatus has a projection module for projecting an image onto a projection surface. An image sensor module captures images of the projection surface and determines spatial and temporal characteristics of a visible light spot superimposed on the projection surface. A communications module transmits the spatial and temporal characteristics of the visible light spot to a remote device for remote control of the device based on the spatial and temporal characteristics of the visible light spot.
US07862178B2

A projection apparatus including an actuator, a light source, and a projection lens is provided. The light source is disposed on the actuator and is capable for emitting light beams sequentially. The actuator is capable for driving the light source so as to change the transmission paths of the light beams. The projection lens is disposed on the transmission paths of the light beams. The volume of the projection apparatus can be reduced since the light source is directly disposed on the actuator.
US07862176B2

A method, computer program product, and data processing system for designing a contact lens. A sagittal image of an anterior portion of an eye having a sclera is measured. Measuring is performed using a digital imaging device. Measuring includes measuring the sclera. A sagittal image is formed. A shape of the eye is derived using the sagittal image, wherein the shape includes the sclera. The shape is converted to a curvature of a contact lens. The curvature is designed such that the contact lens, once manufactured, can be worn over a surface of the eye.
US07862159B2

An ink jet recording head includes a recording element substrate including an ejection outlet array consisting of a plurality of arranged ejection outlets for ejecting ink, a plurality of heat generating elements, provided correspondingly to the ejection outlets, for generating thermal energy for ejecting the ink, and a supply port, formed along the ejection outlet array in an elongated hole-like shape, for supplying the ink to the ejection outlets; and a supporting member, having a supply flow passage communicating with the supply port, for supporting the recording element substrate. The supporting member is provided with at least two beams each extending over an opening of the supply flow passage in a widthwise direction of the supply flow passage and having a width W with respect to a longitudinal direction of the supply flow passage. At least two beams described above are disposed within a range from a center of the supply flow passage with respect to the longitudinal direction toward both longitudinal end sides of the supply flow passage by 2.5 W for each of the end sides and are spaced 2 mm or more apart.
US07862158B2

A method of manufacturing an ink jet head which discharges ink, comprising: a step of preparing a silicon substrate; a step of forming a membrane having a layer in which a plurality of holes are disposed to constitute a filter mask, and a layer with which a first surface is coated in such a manner that the first surface is not exposed from the plurality of holes on the first surface of the substrate; a step of forming a close contact enhancing layer on the membrane formed on the substrate; a step of forming a channel constituting member on the close contact enhancing layer to constitute a plurality of discharge ports and a plurality of ink channels communicating with the plurality of discharge ports; a step of forming an ink supply port communicating with the plurality of ink channels in the silicon substrate by anisotropic etching from a second surface facing the first surface of the substrate; and a step of forming a filter in a portion of the close contact enhancing layer positioned in an opening of the ink supply port using the layer of the membrane in which a plurality of holes are disposed as the mask.
US07862155B2

An ink jet head circuit board is provided which has heaters to generate thermal energy for ink ejection. This board has the heaters formed with high precision to reduce their areas. It has provisions to protect the electrode wires against corrosion and prevent a progress of corrosion. The substrate is deposited with the thin first electrodes made of a corrosion resistant metal. Over the first electrodes the second electrodes made of aluminum are formed. The second electrodes are deposited with a resistor layer. The heater is formed in the gap between the first electrodes. With this construction, the heaters are formed without large dimensional variations among them. Should a defect occur in a protective layer above or near the heaters, a progress of corrosion can effectively be prevented because the material of the resistor layer is more resistant to encroachment than aluminum and the first electrodes are corrosion resistant.
US07862152B2

Provided is a printer having a printhead assembly which includes an elongate support beam. The support beam includes a silicon core, an intermediate elastomeric layer mounted to the core and an outer support structure mounted to the elastomeric layer, as well as a plurality of printhead modules mounted to the support beam. The printhead modules and support beam are configured so that the printhead modules are misaligned when the printhead assembly is at a room temperature and move into alignment when the printhead assembly heats up to an operating temperature of the printhead. The printhead assembly also includes a number of fiducials located on the respective printhead modules to allow visual verification of such alignment.
US07862142B2

Pressure fluctuations that occur inside an ink jet head will be controlled. The ink jet head has a body. A common ink storage chamber is formed inside the body. A plurality of nozzles and a plurality of pressure chambers are formed in the surface of the body. One nozzle corresponds to one pressure chamber, and one pressure chamber corresponds to one nozzle. A plurality of individual ink storage chambers are formed inside the body. Each individual ink path extends from the common ink storage chamber, through one corresponding pressure chamber, and to one corresponding nozzle. The ink jet head is provided with an adjustor that allows the volume of the common ink storage space to increase or decrease. When the pressure of the ink that is stored in the ink jet head fluctuates, the volume of the common ink storage space will increase or decrease, and the pressure fluctuations will be smoothed.
US07862137B2

Method and devices for reducing printing artifacts. In one embodiment, a method includes directing ink onto a medium, the medium having a trailing edge; tracking the position of the medium in relation to a nip roller; adjusting the direction of ink onto the medium a first time when the trailing edge of the medium is in close proximity to the nip roller; and adjusting the direction of ink onto the medium a second time.
US07862134B2

Provided is a liquid ejecting apparatus including: pressure generation chambers communicating with nozzle openings for ejecting a liquid; and a liquid ejecting head including pressure generation units which cause pressure variations in the pressure generation chambers, wherein idle nozzles including at least one located adjacent to ejection nozzles in the vicinity of the ejection nozzles are selected according to a liquid ejecting timing from the ejection nozzles for ejecting the liquid from the nozzle openings, the pressure generation unit corresponding to the selected idle nozzles is driven, non-ejection driving for pressurizing the pressure generation chamber communicating with the idle nozzles to a degree not ejecting the liquid is performed, and the non-ejection driving is not performed with respect to the pressure generation unit corresponding to the unselected idle nozzles.
US07862132B2

A dishwasher is provided, comprising a door pivotably attached to a body and having a counterbalance assembly coupled therebetween for facilitating pivoting of the door, wherein the counterbalance assembly includes a biasing member coupled to the body and serially engaged with a flexible element coupled to the door, and a guide member secured to the body and including a fixed arcuate member defining a first guide track, and a pulley rotatable about an axis and defining a second guide track, wherein the flexible element is at least partially wrapped about each of the fixed arcuate member and the pulley so as to serially engage the first and second guide tracks, and wherein the first guide track of the fixed arcuate member is offset from the second guide track of the pulley along the axis thereof.
US07862129B2

The present invention provides an electric parking brake system with one cable that has only one cable between an actuator, serving as a power generator, and parking cables and high flexibility in laying-out for mounting to a vehicle. According to an electric parking brake system with one cable of the invention, an actuator that converts torque of a motor into axial moving force to operate parking cables is manufactured into a single module, a housing that defines the whole external shape of the actuator is formed into an integral unit by injection molding, in which vibration caused by rotation in the operation of the actuator is absorbed by elastic members, so that a small-sized actuator having improved workability in mounting can be obtained and desired performance, such as reduction of operational noise caused by absorption of vibration, can be achieved.
US07862116B2

A seat cushion for an aircraft seat includes a plurality of rear edge securing straps attached to the lower surface of the seat cushion. The rear edge securing straps each have a free end that includes a pull-the-dot fastener that engages a corresponding pull-the-dot fastener at the rear edge of the seat pan. The length of the rear edge securing straps is selected so that when the seat cushion is installed, the rear edge securing straps are pulled substantially flat so that the seat cushion is firmly held in place. The seat cushion is easily removable because the pull-the-dot fasteners are at the ends of the rear edge securing straps rather than affixed directly to the bottom of the seat cushion. Therefore, when the front edge of the seat cushion is released, the seat cushion can be lifted up enough to allow the cushion to be released without pulling at the bottom of the seat cushion.
US07862115B1

An inventive protective device for developing infants is provided, where the protective device is comprised of a triangularly-shaped, padded front portion conforming to the infant's chest, a triangularly-shaped, padded back portion conforming to the infant's back, and a crotch portion connecting the front and back portions. The front and back portions are each constructed of a plurality of tapering tubular-shaped structures extending from the top edge towards the crotch area, with the crotch portion lacking any padding. The inventive protective device fills the gap between the infant's torso and any seating enclosure into which the infant is placed, so as to reduce the chance for injury due to sudden and rapid movement against the enclosure.
US07862104B2

The present invention relates to an impact absorbing member (14L, 14R) for vehicle which has a hollow cylindrical shape and is disposed in a vehicle between a side member (12L, 12R) and a bumper beam (10), and which is axially crushed along an axis of the impact absorbing member by receiving a compressive force into a bellows shape to absorb an impact energy upon deformation, wherein (a) the impact absorbing member includes a main body (20; 80; 90) of a hollow cylindrical shape, and a pair of attaching plates (54, 56) to which both axial ends of the main body are fixedly welded respectively; (b) the main body has, at least one axial end thereof, a flange (68, 70) protruding at least axially and being integrally formed with the main body; (c) the attaching plate has an adhered supporting portion (76) formed in parallel to the flange to be surface contacted therewith; and (d) the main body is fixedly welded to the attaching plate with the flange being surface contacted with the adhered supporting portion.
US07862098B2

A vehicle interior assembly includes an interior panel and trim panel. The interior panel includes an opening and a mating part. The trim panel is snap-fitted into the opening of the interior panel and includes a main body. An accessory opening is provided in the main body adjacent to a first end thereof. The accessory opening is configured to receive an accessory adaptor that is insertable and removable perpendicularly to the first direction of the main body. A retention tab extends away from the first end of the main body along a section of a concealed surface of the interior panel adjacent to the opening and prevents movement of the trim panel perpendicularly to the first direction of the main body. A snap-fit part is releasably secured to the mating part of the interior panel portion.
US07862096B2

An upper glove box for the passenger side of an automotive vehicle in which a door is upwardly hinged and has an upper edge that is received into a void defined in the instrument panel when the door is opened. The revealed wall forward of the opening of the void is an integral portion of the foam injected instrument panel to provide the desired aesthetics.
US07862095B2

Disclosed are methods and apparatus for empowering a toddler or person with a disability to eat whole foods, such as sandwiches, pizza, waffles, burritos, etc. more efficiently than without the aid of the apparatus, which apparatus has two body units, each having surfaces capable of holding a food product between them, and a compression component operationally connected to the two body units that controls the amount of force exerted by the surfaces on the food product when the food product is between the surfaces, at least two handles on the device, which handles project from the body unit, and are adapted to be held by a pair of hands, and an area on each body unit, which permit compression of these areas to move apart the surfaces.
US07862093B2

A novel wire spool caddy for transporting spools of electrical wire is comprised of a handle perpendicularly connected to the upper end of a shaft member. The shaft member is angularly connected to an extension member. The lower end of the extension member is angularly connected to the upper end of a second shaft member. An axis member is perpendicularly connected to the second shaft member. The axis member has an interior and exterior retaining cap for the purpose of retaining a coaxial rotational member which supports a wire spool when it is placed on the wire spool caddy. During use, the wire spool caddy allows the operator to guide and transport a wire spool by pushing it along.
US07862087B2

A reusable safety apparatus for reducing the forward velocity of an occupant of a vehicle involved in a collision or another event that imparts forward velocity to the occupant of a vehicle comprising essentially of a casing member, a piston member substantially housed in the casing member, a piston resistance mechanism, and a piston release mechanism; the apparatus is fixedly attached in between a seatbelt anchor of a vehicle and the webbing material of a seatbelt.
US07862083B2

An actuation mechanism is used with the deployment apparatus mounting a running board on an automotive vehicle for laterally outward movement to increase rollover resistance for the vehicle. The actuation mechanism includes a cup with a hollow tube attached thereto to provide a path for the movement of a ball from the cup into engagement with the latching mechanism on the deployment apparatus. The ball is retained within the cup member until the actuation mechanism and the automotive vehicle to which it is mounted tilts to a minimum roll angle, whereupon the ball is released to roll down the hollow tube into engagement with the latching mechanism of the deployment apparatus. In one embodiment, a single cup with a pair of laterally extending tubes directs the ball to the deployment apparatus that requires actuation. In other embodiments, a separate actuation mechanism is provided for each respective deployment apparatus.
US07862079B2

A steering column device with a knee airbag device includes a steering column provided with a telescopic mechanism; a column cover that covers the rear end portion of the steering column; an airbag module, provided inside the column cover, which includes a gas generation device that generates gas, and a knee airbag that is inflated and deployed by the gas; an airbag door that is provided in the column cover, and that is opened when the airbag door receives the inflation pressure of the knee airbag; a collision prediction device that predicts that a vehicle will have a collision with a collision object; and a control device that operates the telescopic mechanism so that each of the column cover and the airbag module is moved rearward to a predetermined position, when the collision prediction device predicts that the vehicle will have a collision with the collision object.
US07862075B2

A curtain airbag bracket is used to assemble a curtain airbag having an attaching piece, and an inflator connected to the curtain airbag, and to attach the same to a vehicle body. The inflator is connected to the curtain airbag for supplying a pressurized fluid for developing the curtain airbag. The curtain airbag bracket includes an airbag bracket having an airbag-attaching portion for attaching the attaching piece of the curtain airbag to hold the curtain airbag, and an inflator bracket coupled with the airbag bracket for holding the inflator so that the inflator is substantially in parallel with and adjacent to the curtain airbag. The airbag-attaching portion faces the inflator bracket with a gap therebetween.
US07862071B2

An automotive interior trim for improving deployment safety of seamless passenger airbags for instrument panel is disclosed. The interior trim, mounted on an deployment opening of an airbag module of a framework for a instrument panel, includes a framework with an airbag deployment opening for a instrument panel, an airbag cover covering the airbag deployment opening, a foaming interlayer, a surface layer, and a netlike additional layer which is integrally combined with the foaming interlayer after penetrated by a foam material. When the airbag bursts, the airbag cover is opened outwards and the surface layer of the instrument panel is torn, and the foaming interlayer is torn thereupon too. Under the effect of the netlike additional layer, the foam in the foaming interlayer is fixed by the additional layer, thereby avoiding crumb and hard particle production and improving the deployment safety of the airbag greatly.
US07862070B2

Described is an airbag flap system, and to a method for producing this airbag flap system. The airbag flap system contains an airbag cover and a carrier. The airbag cover comprises at least up to 80 percent by weight of a first plastic material, the carrier comprises at least up to 80 percent by weight of a second plastic material. The first plastic material thereby has a lower bending modulus than the second plastic material. The airbag cover has a border which extends at least partially into the carrier and is covered by the carrier on the upper and lower side.
US07862063B2

The invention is a frame for a bicycle or other two wheeled vehicle that utilizes convoluted curves in its structure providing function in utility and manufacture as described here with this disclosure, as well as ornamental form as described by the subject complementing disclosure by design patent application No. 29/243,986. The specific utility that is offered by this invention is a suspension quality inherent to the frame itself. The frame serves as a suspension system isolating the vehicle rider from the displacements of the vehicle wheels forced by the irregularities that may exist in a road over which the vehicle may travel. A specific quality of manufacture offered by this invention is a frame that avoids the necessity of tube and tube joints, and likewise an otherwise necessary welding or fusion of such tube joints.
US07862060B2

A front suspension apparatus includes a plurality of links suspending an axle member. First and second lower link members are arranged to dispose the second lower link member at a more rearward position than the first lower link member, to cause an imaginary line connecting both attaching points of the second lower link member to have a smaller angle than that of an imaginary line connecting both attaching points of the first lower link member relative to a line extending right in the vehicle-width direction as viewed from above of the vehicle, to cause the imaginary line of the second lower link member to overlap with a shaft portion of the axle member as viewed from the above, to locate the axle-member-side attaching point of the second lower link member at a more downward position than the axle-member-side attaching point of the first lower link member, and to locate the axle-member-side attaching point of the first lower link member more inwardly in the vehicle-width direction than the axle-member-side attaching point of the second lower link member.
US07862056B2

A tunable mass damper for use in a vehicle steering system in which a rack and pinion gearing subsystem would otherwise transfer resonant vibrations to the vehicle steering wheel. The mass damper element is a generally cylindrical mass supported and suspended around the shaft extending from the pinion gear by several cantilevered spring elements. The mass damper is tunable by modifying the size of the mass or the size or material or length of the springs so that the damper's resonant frequency for axial oscillation matches the resonant vibrations present at the steering shaft extending from the pinion gear.
US07862050B2

A process and apparatus for centering accurately and speedy a workpiece on a magnet chuck mounted on a work spindle. A pair of action pads spaced away from one another comes into engagement with the workpiece attracted to the work spindle, thereby performing the centering operation. The action pads are mounted on a support plate that can freely turn on a fulcrum. As the fulcrum makes head towards a rotational center of the magnet chuck, the action pads comes into abutment in a rocking manner against the workpiece that is held at off-center relation in the chuck, thereby compensating the off-center relation to keep a center of the workpiece in alignment with the rotational center of the chuck.
US07862048B2

A gasket for a valve in an internal combustion engine is provided with a support element having a tubular configuration according to an axis and coaxially mounted on the valve. An elastically deformable element is interposed between the support element and the valve. The support element includes a first portion elongated according to the above mentioned axis, and a second portion extending from the first portion in a direction transversal to the axis, at least partially housed in an annular seat of the elastically deformable element and having its radially outermost end connected to the first portion itself. The support element comprises a third portion extending from the radially innermost end of the second portion and folded on the second portion itself so as to generate, in the folding area, a rounded edge cooperating with the annular seat of the elastically deformable element.
US07862046B2

A mechanical seal assembly including at least one pair of co-operating seal rings, one of which is provided for common rotation with a rotating component and the other of which is provided rotationally fixed at a stationary component. One of the seal rings is axially movable and axially biased with a biasing force against the other seal ring, the biasing force being transmittable through a force transmitting ring to the respective seal ring, in order to bias facing sliding surfaces of the seal rings, between which a sealing gap is formed during operation, in a mutual sealing engagement, and a secondary sealing assembly provided at the force transmitting ring for sealing the axially movable seal ring with respect to at least one circumferential guiding surface of a guiding component guiding the movement of the seal ring and the force transmitting ring.
US07862043B2

A game assembly for housing a foldable game board which is quickly and conveniently secured to an open configuration for game play through the use of a spring loaded flexible hinge. The game assembly includes a first base portion, a second base portion capable of cooperating with the first base portion between an open and a closed configuration, and at least one hinge assembly mounted at a first end to the first base portion and at a second end to the second base portion. The hinge assembly includes a flexible strap and biasing element capable of tensioning the flexible strap to maintain the first and second base portions with respect to each other in an open configuration.
US07862026B2

A bundle claw attached to a sheet conveyor belt includes a concave portion having a bottom surface for regulating a position of a trailing end of the sheets, and, in the bottom surface, a surface on a lower side that comes into contact with the sheet conveyor belt is formed deeper than a surface on an upper side to form the step portion between the surface on the lower side and the surface on the upper side. Therefore, when a small number of sheets are discharged from a processing tray to a stacking tray, a trailing end of the sheets is located on the lower surface side of the concave surface of the bundle claw, where the trailing end of the sheets should be originally located, and does not move to the upper surface side of the concave surface of the bundle claw.
US07862016B2

A receiving member for receiving the leading end of sheet on a sheet placing table is disposed movably along the upper surface of the sheet placing table within a specified range including a first position located at the other end of the sheet placing table and distanced from a carry-in opening at least by the length of the sheet, and an operation control unit causes the receiving member to move to a second position where the trailing end of the sheet received by the receiving member slips under the carry-in opening.
US07862007B2

A lightweight valve (1), in particular for internal combustion engines, is provided, with a valve stem (3), with a hollow valve cone (5) and with a valve disk (7) closing the valve cone hollow space on one side, a valve cone support being provided in the hollow space. The valve cone support is provided at a distance from the valve disk (7).
US07862000B2

A microfluidic structure and method, where the structure comprises a featureless gasket layer allowing for efficient and reproducible structure production and assembly. Layering methods allow for the use of a variety of device materials and easy assembly.
Patent Agency Ranking