US11922157B2
In one embodiment, a system for managing communication connections in a virtualization environment includes a plurality of host machines implementing a virtualization environment, wherein each of the host machines includes a hypervisor, at least one user virtual machine (user VM), and a distributed file server that includes file server virtual machines (FSVMs) and associated local storage devices. Each FSVM and associated local storage device are local to a corresponding one of the host machines, and the FSVMs conduct I/O transactions with their associated local storage devices based on I/O requests received from the user VMs. Each of the user VMs on each host machine sends each of its representative I/O requests to an FSVM that is selected by one or more of the FSVMs for each I/O request based on a lookup table that maps a storage item referenced by the I/O request to I/O the selected one of the FSVMs.
US11922156B2
Systems, methods, and devices facilitate synchronization of content between instances of data records. Servers may be configured to generate a data record comprising a dynamic synchronization data object, receive an input associated with the data record, and determine a plurality of synchronization parameters including a plurality of expansion parameters and a plurality of permission parameters associated with the dynamic synchronization data object. The servers may be configured to determine a plurality of update parameters based on the synchronization parameters, the update parameters identifying if a modification included in the input should be applied to contents of the dynamic synchronization data object. The servers may also be configured to update the data record and the contents of the dynamic synchronization data object based, at least in part, on the determined update parameters, the updating including pushing the updated contents to at least one of the plurality of target data records.
US11922146B2
Various embodiments of the present technology empower business domain experts to create “no-code” enterprise applications with a variety of features (e.g., workflow, multi-currency, etc.). By using the tools of various embodiments, the domain expert just has to know the business and not how to code in order to create enterprise applications. In some embodiments, the domain expert can access a tool that allows the domain expert to convey intent and desires instead of providing code. The intent and desire of the domain expert can then be abstracted, translated, and stored as a metadata representation. The metadata representation can then be used to automatically generate appropriate code artifacts for the applications. The code artifacts can include snippets of code written in a variety of languages. These code artifacts can then be wrapped, using a runtime engine for example, to create the application which can be distributed to the end-users.
US11922138B2
A method for providing a federated, multi-product data mesh via automated code generation is disclosed. The method includes receiving, via an application programming interface, a data model, the data model including model artifacts that define data governance for a data product; automatically generating source code for software components based on the data model, the software components corresponding to data mesh components for the data product; integrating data product customizations into the software components, the data product customizations including business logics and testing configurations; initiating an automated continuous integration and continuous delivery pipeline to generate a service that corresponds to the data product based on the integrated software components; and deploying the generated service in a namespace that corresponds to the data product.
US11922133B2
A method includes processing, by an arithmetic and logic unit of a processor, masked data, and keeping, by the arithmetic and logic unit of the processor, the masked data masked throughout their processing by the arithmetic and logic unit. A processor includes an arithmetic and logic unit configured to keep masked data masked throughout processing of the masked data in the arithmetic and logic unit.
US11922124B2
Method, apparatus and computer program product for generating multi-paradigm feature representations
Methods, apparatus, systems, computing devices, computing entities, and/or the like for programmatically generating multi-paradigm feature representations are provided. An example method may include generating a code dataset including a plurality of codes associated with a predictive entity; generating a plurality of semantic feature vectors based at least in part on code description metadata; generating a plurality of structural feature vectors based at least in part on code relation metadata; generating a plurality of multi-paradigm feature vectors based at least in part on the plurality of semantic feature vectors and the plurality of structural feature vectors; generating a prediction for the predictive entity by processing the plurality of multi-paradigm feature vectors using a prediction model; and performing one or more prediction-based actions based on the prediction.
US11922123B2
Techniques for automatically switching between chatbot skills in the same domain. In one particular aspect, a method is provided that includes receiving an utterance from a user within a chatbot session, where a current skill context is a first skill and a current group context is a first group, inputting the utterance into a candidate skills model for the first group, obtaining, using the candidate skills model, a ranking of skills within the first group, determining, based on the ranking of skills, a second skill is a highest ranked skill, changing the current skill context of the chatbot session to the second skill, inputting the utterance into a candidate flows model for the second skill, obtaining, using the candidate flows model, a ranking of intents within the second skill that match the utterance, and determining, based on the ranking of intents, an intent that is a highest ranked intent.
US11922122B2
Aspects of the present disclosure relate to systems and methods for detecting emerging events. In various examples, a method for detecting emerging events includes obtaining communication data associated with communication between multiple sources, segmenting communication data into multiple segments, determining whether a data segment belongs to a familiar topic or none, and generating a notification when a familiar topic is mentioned for more or less than a mention prediction. Additionally, or alternatively, a notification may be generated when an unfamiliar topic emerges from a set of unfamiliar data segments if an associated segment count exceeds a critical mass threshold. To determine whether a data segment belongs to a familiar topic, the data segment may be transformed into a feature vector and mapped onto a feature space, where a distance-based similarity score may be determined.
US11922121B2
The present disclosure provides a method and an apparatus for information extraction, an electronic device, and a storage medium. The method for information extraction includes: first obtaining text data, and then inputting the text data into an information extraction model obtained through pre-training to obtain triple information contained in the text data, wherein the triple information includes a subject, a predicate and an object in the text data. The information extraction model includes a binary classification sub-model and a multi-label classification sub-model, wherein the binary classification sub-model is configured to extract the subject in the text data, and the multi-label classification sub-model is configured to extract the predicate and the object corresponding to the subject in the text data according to the subject and the text data.
US11922091B2
Provided is a display device or a display system capable of displaying images along a curved surface, a display device or a display system capable of displaying images seamlessly in the form of a ring, or a display device or a display system that is suitable for increasing in size. The display device includes a display panel. The display panel includes a first part and a second part and is flexible. The first part can display images. The second part can transmit visible light. The display panel is curved so that the second part and the first part overlap with each other.
US11922081B2
An information processing apparatus gives an update notification of a firmware of the image printing apparatus and an update notification of a printer driver necessary for the information processing apparatus. The information processing apparatus having a driver that causes the image printing apparatus to execute image printing, includes: a driver information obtaining unit configured to obtain information on firmware update of the image printing apparatus and information on a required version of the driver; an information analysis unit configured to compare a current version of the driver and the information on the required version obtained by the driver information obtaining unit; and a display controlling unit configured to display an update notification screen based on a result analyzed by the information analysis unit and the information on the firmware update obtained by the driver information obtaining unit.
US11922076B2
A print control device used to control printing on a three-dimensional workpiece includes an acquisition unit that acquires workpiece information including information about the number of print surfaces of the workpiece, where an image is printed on each of the print surfaces, a controller that displays, on a display device, a print image setting portion for a user to set an image to be printed on each of the print surfaces, and a reception unit that receives an operation by the user via an input device, wherein the controller changes the number of the print image setting portions to be displayed on the display device according to the workpiece information.
US11922075B2
An image forming apparatus is capable of receiving, from an image control apparatus capable of performing raster image processor (RIP) processing upon data, a print job and executing the received print job. The image forming apparatus includes a storage unit configured to store a print job, an acquisition unit configured to acquire unique information of the image control apparatus from the image control apparatus, and a controller configured to set, for a function of storing the received print job in the storage unit without executing the received print job until a print instruction is received, exception conditions for not storing the received print job. In response to acquisition of the unique information of the image control apparatus, the controller automatically sets the exception conditions based on the unique information.
US11922061B2
Systems, apparatuses, and methods related to a memory device and an associated host device are described. The memory device and the host device can include control logic that allow the memory device and host device to share refresh-timing information, which may allow either the memory device or the host, or both, to manage operations during time that is dedicated to, but unused for, refresh or self-refresh operations. Refresh-timing information shared from the host device may indicate elapsed time since the host device issued a refresh command to the memory device and/or how much time remains before the host device is scheduled to issue another refresh command. Refresh-timing information shared from the memory device may indicate elapsed time since the memory device performed a self-refresh operation and/or how much time remains before the memory device is scheduled to initiate or undergo another self-refresh operation.
US11922059B2
A method of distributedly storing data in a system comprising a plurality of edge nodes communicatively coupled to an end device and a central cloud. The method includes: receiving, by a first edge node, data transmitted by the end device; assigning, by the first edge node, a data tag to received data according to attributes of the received data and duplicating the received data to generate a tagged data copy; and transmitting, by the first edge node, the tagged data copy to at least one second edge node determined by a data distribution policy determined by the central cloud directly or through the central cloud, so that the at least one second edge node store the tagged data copy in a storage.
US11922056B2
An example apparatus can include a memory array and a memory controller. The memory array can include a first portion including a first plurality of memory cells. The memory array can further include a second portion including a second plurality of memory cells. The memory controller can be coupled to the first portion and the second portion. The memory controller can be configured to operate the first plurality of memory cells for short-term memory operations. The memory controller can be further configured to operate the second plurality of memory cells for long-term memory operations.
US11922054B2
Methods, systems, and devices for techniques for temperature-based access operations are described. A memory system may be configured to write temperature information to metadata during a write operation. The temperature information may indicate a temperature range within which the memory system may be during the write operation. The memory system may perform a corresponding read operation based on the temperature information written to the metadata and a temperature of the memory system during the read operation. A server may determine and indicate parameters associated with writing the temperature information to the metadata. Additionally, or alternatively, the server may indicate trim parameters for use in performing read operations based on temperature information received from the memory system. In some examples, the memory system may perform targeted refresh operations at locations based on temperature information stored associated with the locations.
US11922048B2
A memory controller for controlling a memory device which stores logical-to-physical (L2P) segments includes a map data storage and a map manager. The map data storage stores a plurality of physical-to-logical (P2L) segments including mapping information between a physical address of the memory device in which write data is to be stored and a logical address received from a host, in response to a write request received from the host. The map manager updates the L2P segments stored in the memory device, based on target P2L segments corresponding to a write command provided to the memory device, which have a higher priority than the other P2L segments among the plurality of P2L segments. Each of L2P segments includes mapping information between a logical address and a physical address of data stored in the memory device.
US11922033B2
A method for distributed file deletion or truncation, performed by a storage system, is provided. The method includes determining, by an authority owning an inode of a file, which authorities own data portions to be deleted, responsive to a request for the file deletion or truncation. The method includes recording, by the authority owning the inode, the file deletion or truncation in a first memory, and deleting, in background by the authorities that own the data portions to be deleted, the data portions in one of a first memory or a second memory. A system and computer readable media are also provided.
US11922026B2
The disclosed system prevents data loss by creating duplicates of data in parallel. The system creates in parallel a first multiplicity of copies of the data to store in a sub-queue associated with a queue. The system creates a second multiplicity of copies of the data, and stores in parallel the second multiplicity of copies of the data in multiple independent memory locations. The system obtains a copy of the data among the first multiplicity of copies of the data, and creates a third multiplicity of copies of the data based on the copy of the data. The system distributes in parallel the third multiplicity of copies of the data to multiple independent data storage devices.
US11922020B2
A read-disturb-based read temperature information persistence system includes a storage device coupled to a host subsystem. The storage device receives a first instruction from the host subsystem to write first data to the storage device, writes the first data to a first block in the storage device, and determines first read temperature(s) for the first data based on first read disturb information associated with the first block in the storage device. When a second instruction is received from the host subsystem to write second data to the storage device that is an updated version of the first data, the storage device identifies the first read temperature(s) determined for the first data in the first block in the storage device, and writes the second data and a first read temperature indication of the at least one first read temperature to a second block in the storage device.
US11922017B2
The subject technology provides compact, searchable, random-access storage of genome data, particularly for large datasets, such as an entire human genome. The genome data may be stored in binary format, and compressed, in part, by leveraging characteristics of genome data itself, and in a way that maintains searchability of the stored compressed data.
US11922011B2
A data item is programmed to a first set of management units (MUs) associated with a first portion of one or more memory devices. The first portion includes memory cells of a first type. The first set of MUs is associated with a first physical address. A mapping is generated in a virtual MU data structure that associates the first physical address with a set of virtual MUs associated with the one or more memory devices. An entry associated with the data item is added to a logical-to-physical (L2P) table associated with the one or more memory devices. The entry includes an identifier associated with the set of virtual MUs associated with the one or more memory devices. A detection is made that the data item is programmed to a second set of MUs associated with a second portion of the one or more memory devices. The second portion includes memory cells of a second type. The second set of MUs is associated with a second physical address. The mapping is updated to associate the set of virtual MUs with the second physical address.
US11922004B2
Reduced-size user interfaces for providing weather information are disclosed. At an electronic device with a touch-sensitive display, indications of a location and a temperature at the location may be displayed. In some examples, a user may provide input through a touch on the touch-sensitive display and/or through a rotation of a rotatable input mechanism to display additional weather information, such as weather information for another location, another temperature, another time, and so forth. In some examples, the device may obtain data representing an upcoming activity, determine whether the activity is to begin within a threshold amount of time, and display weather information based on the upcoming activity. In some examples, the device may display an affordance at a position to indicate the time of day for which a weather condition is provided.
US11921998B2
The present disclosure generally relates to an avatar editing user interface. The avatar editing user interface includes a first view of an avatar at a first size. A request to enter an editing mode for a first feature of a plurality of avatar features of the avatar enables an editing mode for the first feature and causes a second view of the avatar at a second size to be displayed. The editing mode also shifts the avatar to emphasize the first feature relative to other avatar features.
US11921997B2
User interfaces and methods are disclosed. In some embodiments, a plurality of source artifacts is displayed. A selector is operable to indicate a selected set of the source artifacts. An output artifact is displayed having an output attribute that represents a combination of source attributes from the source artifacts in the selected set. An amount of contribution to the first output attribute by respective ones of the source artifacts in the first selected set is based on a coordinate of the selector relative to coordinates of the source attributes in the first selected set.
US11921993B2
At a computer system, display a first user interface that includes a placement location that is configured to spatially accommodate a respective user interface object of a plurality of user interface objects corresponding to different applications. The plurality of user interface objects includes a first user interface object corresponding to a first application, and a second user interface object corresponding to a second application different from the first application. The first user interface object corresponding to the first application is displayed at the placement location. The computer system detects an occurrence of an event associated with a change in status of the second application corresponding to the second user interface object. In response, the first user interface object is ceased to be displayed at the placement location, and the first user interface with the second user interface object is displayed at the placement location.
US11921988B2
Methods, systems, and apparatus for controlling smart devices are described. In one aspect a method includes receiving image data for an image captured by a camera of a mobile device of a user and determining that the image depicts at least one of a smart device or a physical control for the smart device. In response to determining that that the image depicts a smart device or a physical control for the smart device, identifying one or more user interface controls for controlling the smart device, and generating and presenting, at a display of the mobile device, the one or more user interface controls for controlling the smart device. The method can further include detecting, at the display of the mobile device, user interaction with at least one of the one or more user interface controls, and controlling the smart device based on the detected user interaction.
US11921985B2
The exemplary embodiments describe, inter alia, an apparatus comprising: a processor configured to (1) generate a plurality of graphical user interfaces (GUIs) for interaction with a user to support configuration of a narrative story generator to automatically generate a narrative story based on input data, wherein at least one of the GUIs presents content blocks comprising a story outline in a hierarchical structure, (2) evaluate configuration elements of the narrative story generated using imported sample data, and (3) generate narrative stories based on the configuration of the narrative story generator and the input data.
US11921982B2
A user terminal device and a controlling method thereof are provided. The user terminal device includes a display configured to be divided into a first area and a second area which is larger than the first area with reference to a folding line, a cover disposed on a rear side of the display, a detector configured to detect a user interaction on the display and the cover, and a controller configured to, in response to the display being folded along the folding line such that the first area and the second area face each other, control the detector to detect a user interaction through an exposure area, which is an exposed part of the second area, and the cover, and, in response to the display being folded such that the two parts of the cover face with each other with reference to the folding line, control the detector to detect a user interaction through the first area and the second area.
US11921969B2
At an electronic device with a touch screen display, display a user interface, where the user interface includes at least two windows of an application, a first icon displayed in association with a first window of the at least two windows, and a second icon at a location different from the at least two windows. While displaying the at least two windows, detect a gesture on the touch screen display. In response to detecting the gesture: in accordance with detecting the gesture on the first icon associated with the first window on the touch screen display, remove from the display the first window of the at least two displayed windows corresponding to the gesture; and in accordance with detecting the gesture on the second icon at the location different from the at least two windows of the application, display a new window of the application on the touch screen display.
US11921961B2
A display device including a non-sensing area and a sensing area with a first sensing area and a second sensing area spaced apart from each other in a first direction, includes a light emitting element emitting light, and a sensor unit including a plurality of first sensor electrodes disposed in the first sensing area and extending in the first direction, a plurality of second sensor electrodes disposed in the second sensing area and extending in the first direction, a plurality of third sensor electrodes disposed in the first sensing area and extending in a second direction different from the first direction, a plurality of fourth sensor electrodes disposed in the second sensing area and extending in the second direction, and a connection pattern disposed in the non-sensing area. The connection pattern electrically connects the plurality of third sensor electrodes to the plurality of fourth sensor electrodes.
US11921948B2
A control device includes an exterior panel comprising multiple regions, including a groove region and a surrounding region that surrounds the groove region. The control device further includes a sensor layer comprising one or more sensors to detect touch inputs performed on the groove region and the surrounding region of the exterior panel. The control device further includes a control module configured to operate a plurality of devices. The control module is configured to detect a first touch input performed by a user on the groove region and a second touch input performed on the surrounding region. Based at least in part on the location of the touch inputs the control module operates respective devices of the plurality of devices.
US11921946B2
A display device that senses externally applied pressure and a change in the resonant frequency of a piezoelectric element. The display device includes a piezoelectric sensor layer including a piezoelectric sensor; and a display panel disposed on the piezoelectric sensor layer. The piezoelectric sensor includes: a piezoelectric element having a first electrode, a second electrode facing the first electrode, and a piezoelectric material disposed between the first electrode and the second electrode; an alternating current (AC) voltage generator connected to the first electrode and applies a voltage having a resonance frequency to the piezoelectric element. A sensing circuit connected to the second electrode is configured to measure a change in impedance of the piezoelectric element.
US11921932B2
Method for operating a display and operating device, display and operating device, and motor vehicle
A control device of a display and operating device specifies a graphical configuration of a display element to be displayed by the display device. Based on the specified graphical configuration, at least one light wave parameter for a respective light wave of a group of light waves is ascertained. A totality of the light wave parameters describes an interference pattern which describes an at least partial superposition of the light waves for generating an image representation of the display element. An interference pattern signal which describes the totality of the ascertained light wave parameters is generated and the generated interference pattern signal is transferred to an interference output device of the display and operating device. Based on the transferred interference pattern signal, the interference output device generates a light wave interference, and an output of a real image of the display element is displayed.
US11921929B2
Provided is a stereoscopic surface display device including a stereoscopic display unit having a cell area, wherein the stereoscopic display unit includes a first flexible layer, a first optical waveguide and a first optical output unit in the first flexible layer, wherein the first optical output unit are disposed in the cell area, a first light source disposed on a side of the stereoscopic display unit, wherein the first optical waveguide connects the first light source and the first optical output unit, a first photothermal response layer on the first flexible layer, wherein the first photothermal response layer is configured to receive output light emitted from the first optical output unit and emit thermal energy, and a shape deformation layer on the first photothermal response layer, wherein the shape deformation layer is configured to generate bending deformation by receiving the thermal energy from the first photothermal response layer.
US11921919B2
To provide a novel electronic device. The electronic device includes a housing and a display device. The display device includes a first layer, a second layer, and a third layer. The first layer, the second layer, and the third layer are provided in different layers. The first layer includes a driver circuit and an arithmetic circuit. The second layer includes pixel circuits and a cell array. The third layer includes light-receiving devices and light-emitting devices. The pixel circuits each have a function of controlling light emission of the light-emitting device. The driver circuit has a function of controlling the pixel circuits. The arithmetic circuit has a function of performing arithmetic processing on the basis of first data corresponding to currents output from the light-receiving devices and second data corresponding to a potential held in the cell array.
US11921918B2
A method including rendering a view of a virtual environment of a video game for display in a head mounted display of a user, wherein the virtual environment includes a plurality of objects. The method including tracking gaze of the user. The method including detecting that the gaze of the user is directed towards an object in the view for a period of time. The method including generating a heads up display (HUD) interface including information related to the object. The method including surfacing the HUD interface near the object in the view of the virtual environment.
US11921915B2
Disclosed are a head-mounted display system and a manned device. The head-mounted display system comprises: a head-mounted display apparatus, a touch device and a manned terminal apparatus, wherein the touch device is arranged on the manned device and is in communication connection with the manned terminal apparatus, the manned terminal apparatus is arranged on the manned device and comprises a power supply module and a processor module, and the head-mounted display apparatus comprises at least one display screen, is in communication connection with the manned terminal apparatus, and is configured to execute a control operation corresponding to a touch operation performed on the touch device by a passenger user of the manned device. The head-mounted display system enables the passenger to watch the screen content without maintaining a certain posture for a long time, and improves the personalized experience and privacy experience of the passenger.
US11921914B2
The present disclosure relates to methods and systems for providing virtual environments that are responsively adaptable to users' characteristics. Embodiments provide for identifying a virtual action to be performed by a virtual representation of a patient within a virtual environment. The virtual action corresponds to a physical action by a physical limb of the patient in the real-world. In embodiments, the virtual action is required to be performed to a first target area within the virtual environment. Embodiments determine that the patient has at least one limitation that limits the patient performing the physical action. A determination of whether the patient has performed the physical action to at least a physical threshold associated is made. The virtual environment is caused to adapt in order to allow the virtual action to be performed in response to the determination that the patient has performed the physical action to the physical threshold.
US11921902B2
The present disclosure provides a method, system, and device for distributing a software release. To illustrate, based on one or more files for distribution as a software release, a release bundle is generated that includes release bundle information, such as, for each file of the one or more files, a checksum, meta data, or both. One or more other aspects of the present disclosure further provide sending the release bundle to a node device. After receiving the release bundle at the node device, the node device receives and stores at least one file at a transaction directory. After verification that each of the one or more files is present/available at the node device, the one or more files may be provided to a memory of a node device and meta data included in the release bundle information may be applied to the one or more files transferred to the memory.
US11921890B2
An approach is provided for data-preserving trajectory anonymization. The approach involves, for example, processing a plurality of location trajectories to determine one or more exchange twists. The plurality of location trajectories are respectively a sequence of locations points determined by a location sensor of a device, and the one or more exchange twists are one or more locations at which at least two trajectories of the plurality of location trajectories match based on a matching criterion. The approach also involves initiating a swapping of one or more trajectory identifiers among the plurality of location trajectories based on the one or more exchange twists to generate anonymized trajectory data. The approach further involves providing the anonymized trajectory data as an output to a location-based service.
US11921887B2
A request to contact a service provider may be received from a client machine. The request may be associated with an identity claim and including a service identifier. The identity claim may be validated via a distributed identity service that includes a plurality of identity nodes in communication via a network. Validating the identity claim may include determining a designated network identifier associated with a distributed identity account shared among the plurality of identity nodes. A service query that includes the service identifier and the designated network identifier may be sent to a plurality of customer relations management services. A communication session may be established between a service provider remote computing system and the client machine. The service provider may store customer relations management information at a designated one of the plurality of customer relations management services.
US11921886B2
Generating, using artificial intelligence algorithms and a training dataset, at least one machine learning model that is configured to generate scores for multiple attributes of one or more personal data handling approaches associated with a vehicle and/or an in-vehicle unit of the vehicle that handles personal data of a user. The training dataset comprises labelled documents that define the personal data handling approaches, each labelled document having scores pre-assigned to one or more of the multiple attributes of the respective personal data handling approach. Determining one or more personal data handling approaches associated with a target vehicle linked to received vehicle identification information and at least one in-vehicle unit of the target vehicle that handles personal data of the user. Performing semantical analysis of the personal data handling approaches. Generating, using the machine learning model and the personal data handling approaches that have been semantically analyzed, scores for the multiple attributes of each of the one or more personal data handling approaches. Processing the scores to generate a privacy score for the target vehicle, which can be dynamically adjusted for the target vehicle based on privacy change factors.
US11921883B2
This application relates to a client-server architecture that enables user accounts registered with a service to be discoverable to other users of the service. A discovery protocol includes accessing personal information data stored in an address book of a client device, obfuscating the personal information data, transmitting a request to a service to determine if the obfuscated personal information data matches any potential contacts that have registered as discoverable with the service, and comparing information related to the potential contacts with the contacts included in the address book to determine if the contacts in the address book match any of the potential contacts.
US11921882B2
Described is a secure, electronic, submission process providing and enabling applicants to initiate requests to desirous requestors seeking such submissions based on authenticated and trusted identities and/or credentials or which could be authenticated securely through other defined processes. SafeCase is an innovative process for convenience, ease and security in application submissions for anyone and everyone through an electronic interface that has been built innovatively on the strong foundations of Identity Management, giving irrevocable and irrefutable trust on the Identity and/or credentials and/or the purpose that an applicant is applying for or wishes to achieve. SafeCase is an end-to-end secure and transparent interface, wherein the applicant (i.e. the Candidate) utilizes his/her Authenticated Credential(s) or Identity(ies) to submit an application. The applicant remains updated in real time on the status of the submitted application till its final disposal. On the other hand, the Requestor securely receives the said application and gets further updated if and when there is any change to the said submitted identity or credentials thereof.
US11921878B2
An embodiment may involve a database including a table, wherein the table contains database records and a schema by which the database records are arranged. The embodiment may further involve one or more processors configured to: obtain a query that references the table and one or more elements of the schema; copy at least part of the table into a second table; transform, using a deterministic one-way function, the schema of the second table and the database records within the second table; transform, using the deterministic one-way function, the query into a second query; and write, to memory, at least part of the second table and the second query.
US11921875B1
Generally, systems and methods for securely establishing data transfer, storage, and execution are presented. The system may comprise a computing device that comprises at least one programmable integrated circuit. The programmable integrated circuit may comprise multiple independently loadable partitioned segments. A first partitioned segment of the programmable integrated circuit may comprise one or more factory-installed secrets in the form of data, wherein the factory-installed secrets may be configured to convert data from an untranslated state to a translated state, and vice versa. A second partitioned segment may comprise storage-at-rest data for at least one authenticable user of the computing device. The computing device may comprise at least one storage medium that comprises data, including data comprising one or more boot instructions for the computing device, that may be in an untranslated state. Therefore, the computer is not a computer, until it acquires a trusting user's authentication, thereby unlocking its commands.
US11921873B1
Authenticating data associated with a data intake and query system using a distributed ledger system
Systems and methods are disclosed for authenticating a chunk of data identified in a query received by a data intake and query system. The data intake and query system receives a query that identifies a set of data and manner for processing the set of data, and identifies a chunk of data that is part of the set of data. The system generates a content identifier, such as a hash, of the chunk of data. The system further authenticates the chunk of data based on the generated content identifier and a content identifier stored by a distributed ledger system.
US11921867B2
Described are various embodiments of a digital data comparison filter, system and method, and applications therefor. In one embodiment, a digital data comparator system comprises two or more transformation engines each having securely stored in association therewith a common key, a common designated comparator threshold number, and a respective identifier; and a reconstitution engine operable to access partial encryption information from each transformation engine and, only upon relating to identical digital data, process each partial encryption information to successfully release the identical digital data.
US11921866B2
Embodiments disclosed herein are directed to a system and method configured to create a PII profile of the user and monitor data brokers for PII that matches the PII profile. For each data broker, the system can determine a threat level to the user and provide a dynamically updatable user interface configured to present the data brokers in a predetermined order, e.g. descending order of threat. The system can be configured to receive a swipe input from the user to either “Opt-Out” or “Remove” the user PII. “Opting-Out” can include preventing the data broker from selling or sharing the user PII. “Removing” can include requesting the data broker to delete all PII for the user. The system can then monitor the data broker for compliance with the request. Further, the system can provide a user interface to the data broker to petition the user for continued use of the PII.
US11921861B2
Methods, systems, and computer program products for providing the status of model extraction in the presence of colluding users are provided herein. A computer-implemented method includes generating, for each of multiple users, a summary of user input to a machine learning model; comparing the generated summaries to boundaries of multiple feature classes within an input space of the machine learning model; computing correspondence metrics based at least in part on the comparisons; identifying, based at least in part on the computed metrics, one or more of the multiple users as candidates for extracting portions of the machine learning model in an adversarial manner; and generating and outputting an alert, based on the identified users, to an entity related to the machine learning model.
US11921857B2
Various embodiments of the present invention relate to an electronic device for providing a service by using a secure element, and an operating method thereof. The electronic device comprises: a processor for acquiring secure state information of the electronic device; and a secure element operating under the control of the processor, receiving the secure state information of the electronic device from the processor, and including a repository for storing the received secure state information of the electronic device, wherein the secure element senses a security-related service request command, acquires the secure state information about the electronic device from the repository, and can process or ignore the sensed security-related service request command on the basis of whether the acquired secure state information of the electronic device satisfies a designated condition. Other embodiments are also possible.
US11921856B1
Example systems and methods are disclosed for protection of data servers configured for data replication of a database. An example system includes a processing circuit configured to receive records indicating respective modifications performed on a first version of the database stored in a first data server of the plurality of data servers. The processing circuit determines a risk level of a modification indicated by a record based on a set of factors indicated in a security profile, the set of factors being indicative of anomalous data access activity. The processing circuit performs the modification in a second data server, in response to the risk level being less than a threshold level indicated in the security profile. The processing circuit prevents the modification indicated by the record from being performed in the second data server in response to the risk level being greater than or equal to the threshold level.
US11921851B1
The presently disclosed subject matter includes an apparatus that receives a dataset with values associated with different digital resources captured from a group of compute devices. The apparatus includes a feature extractor, to generate a set of feature vectors, each feature vector from the set of feature vectors associated with a set of data included in the received dataset. The apparatus uses the set of feature vectors to validate multiple machine learning models trained to determine whether a digital resource is associated with a cyberattack. The apparatus selects at least one active machine learning model and sets the remaining trained machine learning models to operate in an inactive mode. The active machine learning model generates a signal to alert a security administrator, blocks a digital resource from loading at a compute device, or executes other remedial action, upon a determination that the digital resource is associated with a cyberattack.
US11921838B2
The present invention relates to the secure configuration of electronic devices, such as for example network-connected “smart” devices and appliances, collectively referred to as “IoT devices”. A computer-implemented method of secure configuration of at least one electronic device is provided. According to the method, the electronic device connects to a blockchain database; determines from said blockchain database a configuration block comprising block identification data, where the block identification data corresponds to device identification data, stored with the electronic device; obtains configuration information from said configuration block; and using the configuration information, conducts configuration of the electronic device.
US11921829B2
A communication apparatus includes at least one memory that stores a set of instructions, and at least one processor that executes the instructions, the instructions, when executed, causing the communication apparatus to perform operations including verifying, by communicating with an external device, whether the external device is an external device that passed a predetermined certification, and displaying a screen for selecting an authenticator, wherein on the screen, a display item for an external authenticator verified as the external device that passed the predetermined certification and a display item for an external authenticator that failed to be verified as the external device that passed the predetermined certification are displayed in a distinguishable manner based on a result of the verification.
US11921827B2
Disclosed is a system and method for the monitoring and authorization of an optimization device in a network. In exemplary embodiments, an optimization device transmits an authorization request message to a portal to receive authorization to operate. The portal transmits an authorization response message to the optimization device with capability parameters for operation of the device, including at least one expiration parameter for the authorization. The optimization device sends updated authorization request messages to the portal with its device usage information, such that the portal can dynamically monitor the optimization device and continue to authorize its operation.
US11921826B2
An example embodiment may involve communicating with a server to separately access first and second records of sessions between the server and computing devices of a network, the first record including a first set of fields not present in the second record and the second record includes a second set of fields not present in the first record; identifying a common field present the first and second records; correlating information across the first and second records using the common field; using a set of license misuse criteria to identify, from the correlated information, (i) a set of the sessions that meets the set of criteria and (ii) a network address of a target device involved in the set of sessions; identifying the target device using the network address; and storing an indication identifying the target device as a potential source of misuse of licensed software executable on the server.
US11921819B2
A defense method against adversarial examples based on feature remapping, includes the following steps: building the feature remapping model, the feature remapping model is composed of the significant feature generation model and the nonsignificant feature generation model, and a shared discriminant model, the significant generation model is used to generate significant features, the nonsignificant generation model is used to generate nonsignificant features, and the shared discriminant model is used to discriminate fake or true of generated significant and nonsignificant features. The method combines the significant feature generation model and the nonsignificant feature generation model to build the detector that is used to detect adversarial examples and benign examples; builds the re-recognizer according to the significant feature generation model, the re-recognizer is used to recognize the type of adversarial examples while detecting; connects the detector to the output of the target model, and then use the detector to detect adversarial examples. While recognizing adversarial examples, the method connects the re-recognizer to the output of the target model, and then uses the re-recognizer to recognize adversarial examples. The present invention can achieve dual defense effects of the detection and re-recognition of adversarial examples.
US11921812B2
The present disclosure is directed toward systems, methods, and non-transitory computer readable media for providing a creativity web browser for content creation that integrates features of a content management system with internet browsing capabilities. Specifically, the disclosed systems provide a creativity web browser that includes specialized interface elements for restructuring web browsing to focus on content-related context, including a digital canvas, a content collection pane, an x-ray pane, and other elements. The disclosed systems can provide access to browsing across multiple systems or platforms, such as internet locations and/or locations within a content management system, within an integrated web browsing environment.
US11921811B2
An experimentation platform controls testing of features by an application server. Based on a user identifier, the experimentation platform determines which feature should be provided, and the application server provides the corresponding version of a user interface. If the user behavior data shows that using a tested feature results in an improvement, the tested feature will be adopted. To determine whether or not an improvement is observed, a statistically significant amount of data is gathered. The experimentation platform gathers data regarding user behavior for the feature versions and, in response, adjusts the frequency at which each version is served. Providing the proposed version to an increased percentage of users decreases the total number of page serves required to gather statistically significant data. The experimentation platform may provide an updated projected time to completion of testing based on the changed percentage of users receiving the proposed version.
US11921808B2
A method, computer system, and a computer program product for online posting annotation is provided. The present invention may include identifying a topic in an online posting. The present invention may include determining that a comment to the online posting relates to the online posting. The present invention may include adding at least one detail from the comment to the online posting. The present invention may include tagging the at least one added detail with at least one piece of metadata. The present invention may include validating a viewing access based on the at least one piece of metadata and displaying an amended online posting.
US11921804B2
Systems, methods, and non-transitory computer readable media with instructions for methods here may be used to create and render interactive charts using large amounts of data, by efficiently dividing up the storage and processing of the data between a networked side and a local application side. In certain example embodiments, these two sides work in conjunction with one another, alternatively or additionally, in certain example embodiments, they may act independently and/or alone. The resulting charts may then be used by being embedded in external web pages.
US11921802B2
Methods, systems, and apparatus to constrain a search are described. A selection of one or more items of a search result set by a user may be obtained. One or more attributes of the one or more selected items may be evaluated. One or more filters are identified based on the evaluated attributes.
US11921800B2
The present disclosure provides novel techniques to segment mobile entities based on signals from mobile devices associated with these mobile entities. In certain embodiments, a data file is built for each mobile entity to transform originally extremely high dimensional raw data derived from mobile devices communicating with a network into structured data characterizing associated mobile entities. The data files are structured for filtering and searching with respect to features associated with the signals from mobile devices, including location and non-location features. The data files are used to determine feature gains corresponding respectively to features related to a mobile segment. The features include first features of a first type and second features of a second type. The feature gains are used, among other things, to rank mobile entities for the mobile segment, with feature gains corresponding to the first features given a larger weight than feature gains corresponding to the second features.
US11921797B2
Embodiments include a computer-implemented method for storing comments received at a collaboration page of a content collaboration system in a hierarchical relationship that corresponds to the comments position in a comments field. The method can include receiving a comment at a user interface displaying the collaboration page and creating a thread identification string for the comment having a set of string portions. The method can also include obtaining a comment index file comprising an ordered list of previously-entered comments having respective thread identification strings, adding the comment and thread identification string to the ordered list of previously-entered comments at a location indicated by the thread identification string, designating a pagination of the ordered list of previously-entered comments in the comment index file in accordance with a fixed number of simultaneously viewable lines, and displaying a subset of the ordered list of previously-entered comments in the comment field.
US11921794B2
A communication system provides feedback data for at least one water consuming device. The communication system includes a data collection interface, a controller, and an output interface. The data collection interface is configured to receive user data from at least one collection device. The controller is configured to perform an analysis of the user data from the at least one collection device. The output interface is configured to provide feedback data based on the analysis of the user data to a water consuming device.
US11921789B2
Search engine training apparatus and method and search engine trained using the apparatus and method
An apparatus and method for training a search engine generates synthetic search arguments and target information that are provided to the search engine as training. A search argument simulator ingests product information and historical interaction data, determines relevant descriptors, creates compound descriptors, and creates candidate search arguments. A trainer checks the candidates against historical search arguments, identifies similar search arguments and determines likely search arguments that are used for training. An evaluator monitors search engine responses and triggers retraining of the search engine.
US11921785B2
Techniques described herein allow a user of an RDBMS to specify a graph algorithm function (GAF) declaration, which defines a graph algorithm that takes a graph object as input and returns a logical graph object as output. A database dictionary stores the GAF declaration, which allows addition of GAFs without changing the RDBMS kernel. GAFs are used within graph queries to compute output properties of property graph objects. Output properties are accessible in the enclosing graph pattern matching query, and are live for the duration of the query cursor execution. According to various embodiments, the declaration of a GAF includes a DESCRIBE function, used for semantic analysis of the GAF, and an EXECUTE function, which defines the operations performed by the GAF. Furthermore, composition of GAFs in a graph query is done by supplying, as the input graph argument of an outer GAF, the result of an inner GAF.
US11921783B1
Described herein are systems and methods for extracting and combining XML files of an XFA document. The systems include processors and memory for efficient processing and data storage. The systems can identify XFA documents and generate XML files by parsing the XFA documents. The systems can identify XML nodes within XML files, with each node corresponding to a particular node type, and generate web forms including web nodes, with each web node mapped to a corresponding XML node. The systems can receive input corresponding to the respective node type and store an association between the input received for the web node and the node type and an identifier of an XML node to which the web node is mapped. The systems can update the XML files using the association and generate the populated XFA document by combining the updated XML files according to the schema of the XFA document.
US11921766B2
Described herein are technologies related to constructing supplemental content items that summarize electronic landing pages. A sequence to sequence model that is configured to construct supplemental content items is trained based upon a corpus of electronic landing pages and supplemental content items that have been constructed by domain experts, wherein each landing page has a respective supplemental content item assigned thereto. The sequence to sequence model is additionally trained using self critical sequence training, where estimated click through rates of supplemental content items generated by the sequence to sequence model are employed to train the sequence to sequence model.
US11921754B2
A categorization system can include a computing device that is configured to obtain a plurality of data items over a threshold analysis period from an incoming data database in response to a threshold analysis interval elapsing. The computing device can also be configured to select a categorization model from a model database. The computing device can also be configured to, for each data item of the plurality of data items, apply the categorization model to the data item to identify at least one topic associated with the corresponding data item. The computing device can also be configured to generate a categorization visualization indicating a frequency of data items corresponding to each topic. The computing device can also be configured to transmit the categorization visualization to at least one of: (i) a user interface of an analyst device and (ii) a categorized database.
US11921751B2
Technologies for data capture and data analysis include a system having a knowledge repository in which all input data is stored as objects and relationships between objects, and each object represents at least one container of one or more properties. The knowledge repository is capable of storing the input data according to more than one storage format. The system may also include a user interface providing an input mechanism to obtain the input data, object information that defines one or more of the properties, and relationship information that defines one or more of the relationships. The system includes a controller configured to receive the input data, the object information, and the relationship information from the user interface and to cause the input data to be stored in the knowledge repository as at least one object based on the object information and the relationship information.
US11921750B2
A method and system are provided for assigning a particular record into a chunk of a partition within a non-relational database system. When a number of records in a particular candidate chunk is greater than a particular threshold number, an application performs an auto-balancing operation to split the particular candidate chunk such that records originally assigned to the particular candidate chunk are divided among the particular candidate chunk and a new chunk. Some of the number of records that were originally part of the particular candidate chunk are assigned to a new chunk and the other remaining ones of the number of records that were originally part of the particular candidate chunk remain assigned to the particular candidate chunk.
US11921742B2
A method and apparatus for intelligent visual analysis and display of cross-source heterogeneous data including: when a visual display command for the target heterogeneous data is detected, creating a connector in the distributed in-memory database corresponding to each target data source where the target heterogeneous data is located via a JDBC driver; in the visual data intelligence platform, the python driver of the distributed in-memory database and the SQLAlchemy framework create the connection between the visual data intelligence platform and the distributed in-memory database, and generating SQL table building statements in the visual data intelligence platform based on the association information corresponding to the target heterogeneous data; generating the target data table with plurality of table associations in the distributed in-memory database based on the SQL table building statements; the target heterogeneous data is visualized and displayed in the visual data intelligence platform based on the target data.
US11921733B2
Techniques for fetching query result data using result batches includes generating a plurality of result batches based on query result information. The query result information is associated with query result data generated from execution of a query. Each result batch of the plurality of result batches includes a result data retrieval function for a corresponding data portion of a plurality of data portions of the query result data. The plurality of result batches are encoded for distribution to a corresponding plurality of computing nodes. The techniques further include causing retrieving of the plurality of data portions of the query result data by the corresponding plurality of computing nodes based on the result data retrieval function for each of the plurality of data portions.
US11921727B2
A computer is provided that includes a search engine. The search engine is configured to receive a search request and conduct a search against a database. Each record within the database includes or is associated with a display criteria or profile that specifies when data from that record can be included into a response to a search.
US11921723B2
Cross-tabulation operation is performed within a columnar database management system. The columnar database management system receives a request to perform a cross-tabulation operation on a set of database tables. The columnar database management system determines values of cross-tabulation operation for each row of the result. The columnar database management system determines a domain for each value of the row dimension corresponding to a row combination. The columnar database management system determines an intersection set of the domains corresponding to values of the row dimensions for the row combination. The columnar database management system determines a value for the result column for the row combination as an aggregate value based on the records of the intersection set.
US11921694B2
The present disclosure is directed toward systems and methods that provide users with efficient and effective user experiences when browsing, selecting, or inspecting content items. More specifically, systems and methods described herein provide users the ability to easily and effectively select multiple content items via a single touch gesture (e.g., swipe gesture). Additionally, systems and methods disclosed herein can allow users to select various content items in a selection interface, preview a content item, and return to the selection interface with the previous selections remaining intact. Still further, systems and methods described herein allow users to transition between a content graphical user interface and a selection interface based on touch gestures with content items. Embodiments of the present invention further provide improved navigability by collapsing views of content items.
US11921693B1
A data intake and query system receives a message including raw machine via an internet protocol (IP) such as the hypertext transfer protocol (HTTP). The message includes a distinct payload portion and a distinct custom field portion. The payload portion includes raw machine data, while the custom field portion includes values for fields. An event that includes the raw machine data and the values is generated from the payload portion and the values are extracted from the custom field portion. The event is then stored such that the values are associated with the event.
US11921691B2
A method includes receiving a series of writes that each requests respective data to be stored at a database. For each respective write, the method includes storing the respective data in a first buffer associated with a first data streaming application and a second buffer associated with a second data streaming application. The method includes transmitting the respective data to the database. The method includes receiving, from the database, confirmation that the respective data of the respective write has been committed to the database. The confirmation includes an order indicator indicating an order the respective data of the respective write was committed to the database relative to other writes in the series of writes. In response to receiving the confirmation, the method includes sending the respective data from the first buffer to the first data streaming application and from the second buffer to the second data streaming application.
US11921683B2
Techniques are disclosed relating to processing of time-restricted data records. In various embodiments, a computing system receives a request to store a record that includes a timestamp identifying a time to live (TTL) for the record in a database, with the database being organized in a layered data structure. The computing system stores the record in the database in a particular location in the layered data structure, with the particular location being selected based on the TTL timestamp for the record. The timestamp may be used by a compaction process to indicate that the record TTL has expired and the data record may be written to a message queue by an eviction process.
US11921680B2
A method includes receiving, an operation from a container to synchronize container data from memory to a file system mounted by the container and determining whether the file system indicates that the operation is to be ignored. The method further includes, in response to determining that the file system indicates that the operation is to be ignored, preventing, by the operating system kernel executing on the processing device, performance of the operation.
US11921677B1
Embodiments are directed to sharing namespaces across file system clusters. A file in a spoke file system may be determined based on a command provided to the spoke file system such that the file may be associated with an inode mask. Data blocks associated with the file may be determined based on the command and the inode mask such that the data blocks may be absent from the spoke file system. Requests for leases may be generated based on the absent data blocks such that each lease request corresponds to a portion of the absent data blocks Employing the leases provided by a hub file system to: copy the absent data blocks from the hub file system where each portion of absent data blocks may be associated with a lease; updating the inode mask to include the leases and each copied portion of absent blocks.
US11921676B2
Techniques are described relating to unstructured document processing. An associated computer-implemented method includes identifying a plurality of deduplicated data blocks associated with a collection of unstructured documents. The method further includes sorting the plurality of deduplicated data blocks in descending order based upon at least one block frequency metric, selecting a highest sorted unprocessed deduplicated data block, applying text analytics to the selected deduplicated data block, and applying at least one result of the text analytics to any document among the collection of unstructured documents including the selected deduplicated data block. The method is terminated responsive to satisfaction of at least one stopping condition.
US11921670B1
Use of multivariate data backup retention policies, including: generating a snapshot of a dataset; identifying respective subsets of the dataset that correspond to respective retention policies of a plurality of retention policies; and generating tracking information indicating the respective subsets of the dataset corresponding to the respective retention policies of the plurality of retention policies.
US11921668B2
The present disclosure provides a processor array and a multiple-core processor. The processor array includes a plurality of processing elements arranged in a two-dimensional array, a plurality of first load units correspondingly arranged and connected to the processing elements of the first edge row, respectively, a plurality of second load units correspondingly arranged and connected to the processing elements of the first edge column, respectively, a plurality of first store units correspondingly arranged and connected to the processing elements of the second edge column, respectively, a plurality of second store units correspondingly arranged and connected to the processing elements of the second edge row, respectively.
US11921666B2
A method includes detecting a voltage at a configuration terminal of a mobile industry processor interface (MIPI) radio frequency front end (RFFE) device with a timing based on a MIPI RFFE signal received by the MIPI RFFE device, and setting an address for the MIPI RFFE device based on the detected voltage.
US11921664B2
A storage device includes NVM package and a controller connected to the NVM package through a channel and controlling operation of the NVM package. The NVM package includes an interface chip, first NVM devices connected to the interface chip through a first internal channel and second NVM devices connected to the interface chip through a second internal channel. The interface chip selects the first internal channel in response to an operation request received from the controller and connects the first internal channel to the channel. The interface chip also determines whether retraining is necessary in relation to the second internal channel and transmits a retraining request to the controller when retraining is necessary.
US11921663B2
An electronic apparatus and a USB interface switching method. The electronic apparatus includes: a first control component corresponding to a first operating system, a second control component corresponding to a second operating system, a USB interface, and a USB interface switching circuit. The first control component is used to detect the data transmission state between the USB interface and the first control component. The second control component is used to detect the data transmission state between the USB interface and the second control component.
US11921654B2
A hardware functional module sends, to an aggregation module and in a standardized message format, first status information associated with the hardware functional module according to a first set of reporting rules via a first dedicated link. The firmware functional module sends, to the aggregation module and in the standardized message format, second status information associated with the firmware functional module according to a second set of reporting rules via a second dedicated link. The aggregation module aggregates the first status information in the standardized message format and the second status information in the standardized message format and inserts a timestamp to obtain a timestamped and aggregated message stream. The timestamped and aggregated message stream enables a visualization system to analyze the hardware functional module and the firmware functional module.
US11921652B2
In one embodiment, a host controller includes: a first input/output (I/O) buffer to couple to a first communication line of an interconnect; a second I/O buffer to couple to a second communication line of the interconnect; and a device group selection circuit to dynamically cause the first communication line to communicate a clock signal to a first device group including one or more first devices to couple to the interconnect and dynamically cause the second communication line to communicate a data signal to the first device group when a communication is to be addressed to at least one of the one or more first devices of the first device group, such that the communication is transparent to at least another device group to couple to the interconnect. Other embodiments are described and claimed.
US11921645B2
The present disclosure includes systems and methods for securing data direct I/O (DDIO) for a secure accelerator interface, in accordance with various embodiments. Historically, DDIO has enabled performance advantages that have outweighed its security risks. DDIO circuitry may be configured to secure DDIO data by using encryption circuitry that is manufactured for use in communications with main memory along the direct memory access (DMA) path. DDIO circuitry may be configured to secure DDIO data by using DDIO encryption circuitry manufactured for use by or manufactured within the DDIO circuitry. Enabling encryption and decryption in the DDIO path by the DDIO circuitry has the potential to close a security gap in modern data central processor units (CPUs).
US11921640B2
A cache may store critical cache lines and non-critical cache lines, and may attempt to retain critical cache lines in the cache by, for example, favoring the critical cache lines in replacement data updates, retaining the critical cache lines with a certain probability when victim cache blocks are being selected, etc. Criticality values may be retained at various levels of the cache hierarchy. Additionally, accelerated eviction may be employed if the threads previously accessing the critical cache blocks are viewed as dead.
US11921637B2
In described examples, a processor system includes a processor core that generates memory write requests, a cache memory, and a memory controller. The memory controller has a memory pipeline. The memory controller is coupled to control the cache memory and communicatively coupled to the processor core. The memory controller is configured to receive the memory write requests from the processor core; schedule the memory write requests on the memory pipeline; and contemporaneously with scheduling respective ones of the memory write requests on the memory pipeline, send to the processor core a write acknowledgment confirming that writing of a data payload of the respective memory write request to the cache memory has completed.
US11921631B2
A method, system and apparatus for protecting against out-of-bounds references, including storing an address of a buffer in a general register and storing bounds information (BI) for the buffer in a bounds information register, and when a content of the general register is used as an address in a load or store operation, using a content of the bounds information register to determine if the load or store is out of bounds.
US11921626B2
A processing-in-memory includes: a memory; a register configured to store offset information; and an internal processor configured to: receive an instruction and a reference physical address of the memory from a memory controller, determine an offset physical address of the memory based on the offset information, determine a target physical address of the memory based on the reference physical address and the offset physical address, and perform the instruction by accessing the target physical address.
US11921623B2
Embodiments provide a device for testing a bit sequence generated by a Random Number Generator, wherein the device is configured to apply one or more statistical tests to the bit sequence, in response the detection of N bits generated by the Random number generator, each statistical test providing at least one sum value derived from the bits of the sequence, the testing device comprising: a comparator for comparing at least one test parameter related to each statistical test to one or more thresholds; a validation unit configured to determine if the bit sequence is valid depending on the comparison made by the comparator for each statistical test; wherein at least one of the test parameter and the at least one threshold is determined from N and from a target error probability.
US11921620B2
Provided are a computer program product, system, and method for generating a visualization of blocks of code statements related to errors in a log file. A log file logs errors in execution of program code. Source code, from which the program code is compiled, is analyzed to determine blocks of statements in the source code whose execution resulted in the errors in the log file. Blocks of statements in the source code are annotated with the errors in the log file caused by the blocks of statements. Execution of a block of statements annotated with an error resulted in the error logged in the log file. The annotated blocks of statements are processed to generate a video providing a visualization of the blocks of statements in the source code whose execution resulted in the errors.
US11921613B2
The disclosed techniques assist in diagnosing performance problems of a software application. A profiling module dynamically instruments the application at runtime by intercepting a request to compile one of the application's functions and augmenting the function with performance measuring code. This way, instrumentation is installed without recompiling the application. The execution time of a synchronous function is tracked by adding a local variable that stores function entry time, and by inserting code at each function exit point that computes the elapsed time. The execution time of an async function that executes across multiple threads is measured by repurposing a state machine value to also store the initial function entry time. Instrumented functions that are executed at a rate exceeding a threshold are un-instrumented to avoid self-inflicted performance problems. Function invocations associated with a particular activity, such as responding to a particular web request, may be correlated.
US11921612B2
In exemplary embodiments, a computer system detects performance anomalies for user computer services. Physical databases convert physical database KPIs into logical database KPI vectors for individual user services and individual time intervals. Physical application servers convert physical application server KPIs into logical application server KPI vectors for the individual user services and time intervals. Physical web servers convert physical web server KPIs into logical web server KPI vectors for the individual user services and time intervals. A KPI server combines the logical database KPI vectors, the logical application server KPI vectors, and the logical web server KPI vectors for individual time intervals into user service KPI vectors for the individual user services during the time intervals. The KPI server detects outlier user service KPI vectors as compared to normal user service KPI vectors and indicates corresponding computer performance anomalies for the user services.
US11921607B2
Executing targeted workloads in virtual desktop environments using input encoded into digital images
Techniques are described providing improved ways to benchmark and validate virtual desktop deployments where targeted workloads are delivered to virtual desktops based on parameters such as the desktop type and origin, and where workload operations can be triggered from the client device. Client instructions for performing workload operations can be encoded into a digital image such as a Quick Response (QR) code on the virtual desktop and inserted into the virtual desktop graphical user interface (GUI). The client decodes the digital image in the received GUI to obtain the instructions and actuate the operations. Completion of operations can be tracked to benchmark desktop performance.
US11921605B2
Approaches for managing applications in a cluster are described. In an example, a first agent may be executing on a first programmable network adapter card installed within a first computing node within a cluster. The first agent may isolate an application executing on the first computing node. Thereafter, the application may be managed by the second computing node.
US11921604B2
The technology disclosed herein can be used to evaluate system recovery using emulated production systems. In accordance with one example, the technology can involve accessing state data of a target computing device that is in a production environment, the state data can include a performance measurement of a target computing device; updating a configuration of a computing device to adjust a performance of the computing device to correspond to the performance measurement of the target computing device; introduce, by the processing device, a disturbance to the computing device; determining, by the processing device, a performance of the computing device at a time after the introducing the disturbance; and generating performance data indicating an effect the disturbance has on the computing device.
US11921602B2
In some aspects, an edge-based data collection system discovers, collects, processes, and forwards data in an observability pipeline system. In some implementations, an edge agent of the observability pipeline system runs on a computer node. The edge agent identifies processes running on the computer node; identifies files on the computer node that the processes have opened for writing; accesses log discovery parameters of the observability pipeline system; selects a plurality of files from the identified files according to the log discovery parameters; generates a list of discovered log files that includes a path and a name for each of the plurality of files; adds the list of discovered log files to a list of monitored log files to be monitored by the observability pipeline system; and then monitors the plurality of files to generate input for the observability pipeline system.
US11921598B2
Example techniques may be implemented as a method, a system or more non-transitory machine-readable media storing instructions that are executable by one or more processing devices, Operations performed by the example techniques include obtaining data representing results of tests executed by one or more test instruments on an initial set of devices under test (DUTs) in a test system; and using the data to train a machine learning model. The machine learning model is for predicting which of the tests will produce failing results for a different set of DUTs. DUTs in the different set have one or more features in common with DUTs in the initial set.
US11921591B2
An illustrative media agent (MA) in a data storage management system instructs a NAS file server (filer) to restore an MA-created synthesized-copy instead of larger filer-created backup copies. The synthesized-copy is designed only for the particular files to be restored and mimics, and is typically much smaller than, a filer-created backup copy. The synthesized-copy is fed to the filer on restore as a “restore data image.” When receiving a restore request for certain backed-up data files, the MA synthesizes the synthesized-copy on the fly. The MA generates a header mimicking a filer-created backup header; extracts files from filer-created backup copies arranging them within the synthesized-copy as if in filer-created backups; and instructs filer to perform a full-volume restore from the synthesized-copy. The MA serves the synthesized-copy piecemeal as available, rather than waiting to synthesize the entire synthesized-copy. The synthesized-copy is not stored at the MA.
US11921586B2
A method for performing a data backup process on a cluster includes: obtaining a backup generation request for virtual machines; in response to obtaining the backup generation request: generating a first set of backup groupings based on the backup generation request where each of the first set of backup groupings includes at least one of the virtual machines; issuing a disable migration command to a plurality of production hosts where each of the plurality of production hosts is associated with at least one of the virtual machines; identifying, after the issuing, a virtual machine of the virtual machines that is migrating; removing, based on the identifying, the virtual machine from the first set of backup groupings to obtain a second set of backup groupings where the virtual machine is placed in an excluded group after the removing; and backing up the second set of backup groupings.
US11921582B2
A computer system is configured to manage a value of a variable via firmware. Managing the value of the variable includes detecting a system management interrupt (SMI), causing the computer system to enter a system management mode, in which a request associated with the SMI is handled by the firmware. In response to determining that the SMI is generated by a baseboard management controller (BMC) and that a cause thereof is associated with reading or writing a value of a variable, one or more parameters associated with the variable are obtained from the BMC. Based on the cause of the request and the one or more parameters, the value of the variable is read or overwritten with a new value. The value or the new value is then sent to the BMC, which in turn passes the value or new value to a second computer system over a network.
US11921579B2
A method of operating a memory device is provided. The method includes: receiving a first command from a controller; activating a page of a memory cell array based on the first command; reading data of the activated page; detecting an error from the read data; correcting the detected error to generate error correction data; writing back the error correction data to the activated page in based on the detected error being a single-bit error; and blocking write-back of the error correction data to the activated page based on the detected error being a multi-bit error.
US11921572B1
One example method includes receiving input from each degradation module in a group of degradation modules, and each of the degradation modules operates to track degradation of a respective dimension of a digital twin, determining, using the input, the individual degradation of each of the dimensions of the digital twin, determining, using the individual degradations for the dimensions, an overall degradation for the digital twin as a whole, and identifying, and implementing in an entity represented by the digital twin, a remedial action corresponding to one of the individual degradations.
US11921571B2
A non-transitory computer-readable medium stores instructions readable and executable by at least one electronic processor (10, 12, 14) to perform a log pattern analysis method (300) by applying a log pattern to log data undergoing analysis comprising log events which are time stamped and which are defined by values for a set of fields. The log data undergoing analysis are stored on a server (30) accessible by the at least one electronic processor via an electronic network (31). The log pattern analysis method includes: constructing a retrieval query to select log events that are in a time interval and that also satisfy at least one additional constraint associated with the log pattern and defined on one or more filter fields of the set of fields; downloading a sub-set of the log data undergoing analysis from the server to the at least one electronic processor via the electronic network, wherein the sub-set is selected from the log data undergoing analysis by the retrieval query; applying the log pattern to the downloaded sub-set of the log data undergoing analysis to identify log pattern hits in the log data undergoing analysis; and controlling a display screen (16) to display a report of the log pattern hits in the log data undergoing analysis.
US11921561B2
For a neural network inference circuit that executes a neural network including multiple computation nodes at multiple layers for which data is stored in a plurality of memory banks, some embodiments provide a method for dynamically putting memory banks into a sleep mode of operation to conserve power. The method tracks the accesses to individual memory banks and, if a certain number of clock cycles elapse with no access to a particular memory bank, sends a signal to the memory bank indicating that it should operate in a sleep mode. Circuit components involved in dynamic memory sleep, in some embodiments, include a core RAM pipeline, a core RAM sleep controller, a set of core RAM bank select decoders, and a set of core RAM memory bank wrappers.
US11921559B2
Embodiments are directed to a power grid distribution for a deterministic processor. The deterministic processor includes a plurality of functional slices, a plurality of data transport lanes for transporting data across the functional slices along a first spatial dimension, and a plurality of instruction control units (ICUs). An instruction in each subset of the ICUs includes a functional slice specific operation code and is transported to a corresponding functional slice along a second spatial dimension orthogonal to the first spatial dimension. A power supply grid of metal traces is spread across the first and second spatial dimensions for supplying power to the functional slices and the ICUs. At least a portion of the metal traces are routed as discontinuous stubs along the first spatial dimension or the second spatial dimension.
US11921558B1
In one embodiment, a processor includes: a plurality of cores to execute instructions; a power controller to control power consumption of the plurality of cores, the power controller to receive network traffic metadata from a classifier and control the power consumption of at least one of the plurality of cores based at least in part on the network traffic metadata; and a hardware feedback circuit coupled to the plurality of cores, the hardware feedback circuit to determine hardware feedback information comprising an energy efficiency capability and a performance capability of at least some of the plurality of cores based at least in part on the network traffic metadata. Other embodiments are described and claimed.
US11921556B2
A system includes a data storage device and a host computing device. The data storage device includes a host interface; integrated circuit memory cells; and a processing device. The processing device is configured to execute firmware to perform operations requested by commands received via the host interface and maintenance operations identified by the processing device independent of commands received via the host interface. The host computing device is coupled to the host interface to provide commands with addresses to access the integrated circuit memory cells according to the address. In response to a request, the host computing device is configured to reduce, to below a threshold, a rate of transmitting to the host interface commands to access integrated circuit memory cells; and power up the data storage device to cause the data storage device to perform the maintenance operations.
US11921553B2
According to an embodiment disclosed in the present document, an electronic device may include: a lens frame at least partially including a thermally conductive material; a pair of wearable members which can be rotatably coupled to the lens frame; at least one lens disposed in the lens frame; and transparent conductive lines disposed on the lens. The transparent conductive lines may be connected to the thermally conductive material of the lens frame to receive heat transferred from the lens frame. Other various embodiments are possible.
US11921550B2
A circuit board, a display panel and a display apparatus are provided. The circuit board includes a main circuit board and an adapter circuit board stacked on the main circuit board. The adapter circuit board is provided with at least one first pad region, and the first pad region includes a hollowed region penetrating through the adapter circuit board and multiple first pads distributed around the hollowed region. The main circuit board is provided with at least one second pad region including multiple second pads, and the first pads of each of the first pad regions are respectively soldered to the multiple second pads of a corresponding second pad region.
US11921548B2
The present disclosure is directed to a detection method of a first or second state of a foldable electronic device including a first and a second hardware element tiltable to each other and accommodating a first and a second electrode which are in contact with each other when the foldable electronic device is in the first state and at a distance from each other otherwise. The detection method includes: acquiring a first and a second charge variation signal indicative of environmental electric/electrostatic charge variations detected by the first and second electrodes; generating a differential signal indicative of a difference between the first and the second charge variation signals; generating, as a function of the differential signal, one or more feature signals; and generating, as a function of the one or more feature signals, a contact signal indicative of the first or second states of the foldable electronic device.
US11921544B1
A ground accessible internet of things (IOT) base, cabinet and block with enclosures can rigidly support IOT devices mounted on vertical poles. The block can weight 2,000 pounds or more and can be placed on a ground surface and provide a rigid support for elongated poles. The block does not require digging or excavation of the ground. IOT electrical components that can be placed in protective enclosures within the block or attached to the elongated pole. The cabinet and base supports solar pane allowing tilting poles and enclosures to be mounted between them.
US11921541B2
A display device includes a display module including a folding area and a non-folding area, an impact absorbing layer disposed under the display module and including a bending area and a non-bending area, and a support layer disposed under the impact absorbing layer and including a first sub-support layer overlapping a first non-folding area and a second sub-support layer spaced apart from the first sub-support layer and overlapping a second non-folding area. The first sub-support layer includes a first opening group formed through the first sub-support layer and spaced apart from a first cross-section surface adjacent to the second sub-support layer in a direction opposite to a second direction, and the second sub-support layer includes a second opening group formed through the second sub-support layer and spaced apart from a second cross-section surface adjacent to the first sub-support layer in the second direction.
US11921526B2
A method for controlling a heated process of an electric heater includes obtaining a setpoint variable indicating a target temperature of the heater. The method includes identifying an energy profile for the heater based on the setpoint variable. The energy profile provides a defined magnitude of initial electrical energy to be applied to the heater to have a temperature of the heated process reach the target temperature. The method includes obtaining a process variable indicating a performance characteristic of the heated process. The method includes providing electrical energy to the heater based on at least one of the energy profile and the process variable.
US11921525B1
A fluid supply system and method is provided that includes a fluid pump, a pressure sensor, a pressure relief valve (PRV), and a fluid monitoring device. The fluid pump receives fluid from a first conduit and discharges fluid into a second conduit. The pressure sensor produces sensed fluid pressure signals. The PRV is in signal communication with the pressure sensor. The fluid monitoring device includes a control orifice in fluid communication with second and third conduits. The second conduit has a first inner diameter, the third conduit has a second inner diameter, and the control orifice has an orifice inner diameter, and the orifice inner diameter is less than the first and second inner diameters. The pressure sensor senses fluid pressure in the third conduit at a position in close proximity to the control orifice. The fluid monitoring device may be in a lead or a lag domain configuration.
US11921521B2
A method of controlling an aircraft having multiple configurations is provided, wherein each configuration is controlled by a different control law implemented by a flight control device and transition from one configuration to another configuration is achieved by gradually blending out a control law for one configuration and by gradually increasing an impact of a control law for another configuration in the flight control device based on an estimated flight condition of the aircraft by dynamically adjusting, in the flight control device, respective maximum and minimum limit values of control volumes, which control volumes are defined by parameter ranges of control parameters in connection with a corresponding control law for the one configuration and for the other configuration, respectively.
US11921520B2
Systems and methods for coordinating and controlling vehicles, for example heavy trucks, to follow closely behind each other, or linking to form a platoon. In one aspect, on-board controllers in each vehicle interact with vehicular sensors to monitor and control, for example, gear ratios on vehicles. A front vehicle can shift a gear which, via a vehicle-to-vehicle communication link, can cause a rear vehicle to shift gears. To maintain a gap, vehicles may shift gears at various relative positions based on a grade of a road.
US11921516B2
Provided is a driving assistance system using a magnetic marker capable of providing more pieces of information. In the driving assistance system for assisting driving of a vehicle, a magnetic marker (1) including a magnet sheet (11) serving as a magnetism generating unit which generates a magnetic field and also an RFID tag (15) as an information providing unit which provides information to a vehicle side is laid on a travelling road of the vehicle, and the vehicle includes a magnetic sensor serving as a magnetism detecting unit which magnetically detects the magnetic marker (1) and also a tag reader as an information acquiring unit which acquires the information provided by the RFID tag (15) included in the magnetic marker (1).
US11921515B1
A method for determining at least one action of a robot, including capturing, with an image sensor disposed on the robot, images of objects within an environment of the robot as the robot moves within the environment; identifying, with a processor of the robot, at least a first object based on the captured images; and actuating, with the processor, the robot to execute at least one action based on the first object identified, wherein the at least one action comprises at least generating a virtual boundary and avoiding crossing the virtual boundary.
US11921514B2
According to an embodiment of the present disclosure, a mobile robot may include an outer cover including an insulating material and defining an appearance; an inner cover including an insulating material and configured to define a predetermined gap with respect to the outer cover; a battery disposed inside the inner cover; and at least one pressure sensing module disposed in the gap between the outer cover and the inner cover. The pressure sensing module may include an outer metal panel contacting an inner periphery of the outer cover, an inner metal panel contacting an outer periphery of the inner cover and spaced apart from the outer metal panel, and a pressure sensing sheet pressed between the outer metal panel and the inner metal panel and having a variable resistance. The battery may generate an electric potential difference between the outer metal panel and the inner metal panel.
US11921512B2
Described herein are methods and systems for generating shared collaborative maps for planting or harvesting operations. A method of generating a collaborative shared map between machines includes generating a first map for a first machine based on a first set of data and generating a second map for a second machine based on a second set of data. The method further includes generating at least one shared collaborative map for at least one of the first and second machines based on the first and second maps.
US11921501B2
An automatic driving system includes a control device that controls automatic driving of a vehicle, and a storage device that contains external environment information indicating an external environment of the vehicle. A driving transition zone is a zone in which a driver of the vehicle takes over at least a part of driving of the vehicle, from the control device. A termination target velocity is a target velocity of the vehicle at an end point of the driving transition zone. The control device variably sets the termination target velocity, depending on the external environment at the end point or the external environment surrounding the end point. Then, the control device controls the velocity of the vehicle in the driving transition zone, such that the velocity of the vehicle at the end point is the termination target velocity.
US11921500B2
Technology for generating and displaying a graphical user interface for operating an unmanned aerial vehicle (UAV) is disclosed herein that generates and updates a representation of a spline flight path. In various implementations, a graphical user interface detects user interactions with a remote control device directing the flight control subsystem of the UAV to record keyframes and to compute a spline based on the keyframes during flight. The graphical user interface displays a real-time perspective of the UAV with a representation of the spline and the keyframes overlaying the view. The graphical user interface continually updates the representation as the UAV flies and when the spline is updated as the keyframes are updated.
US11921483B2
A building management system (BMS) provides feedback to a user via a user interface to assist the user in configuring the BMS. It can be challenging for new or less experienced users to understand all of the actions they are performing when configuring a BMS. The feedback presented via the user interface includes graphical and textual feedback to alert the user of actions performed when applying tags. The feedback identifies one or more missing requirements associated with the tags. The feedback presented via the user interface also includes textual summaries of control sequences configured using the BMS. The textual summaries include descriptions of control sequences and instructions for properly configuring the building equipment.
US11921480B2
A system and method for allocating exported energy in a utility network is provided. A system and method comprising measuring the exported energy and a consumed energy via one or more IoT edge devices connected to a cloud computing infrastructure and coupled to one or more distributed energy resources in a community of energy consumers via a telecommunication network. Storing the measured exported energy and consumed energy on a memory coupled to a processor in the cloud computing infrastructure. Selecting one or more allocation algorithms executed by the processor based on the measured exported energy. Distributing and assigning the exported energy according to the one or more allocation algorithms selected and differentiating the community of energy consumers based on the one or more allocation algorithms selected.
US11921478B2
A system and method to determine building thermal performance parameters through empirical testing is described. The parameters can be formulaically applied to determine fuel consumption and indoor temperatures. To generalize the approach, the term used to represent furnace rating is replaced with HVAC system rating. As total heat change is based on the building's thermal mass, heat change is relabeled as thermal mass gain (or loss). This change creates a heat balance equation that is composed of heat gain (loss) from six sources, three of which contribute to heat gain only. No modifications are required for apply the empirical tests to summer since an attic's thermal conductivity cancels out and the attic's effective window area is directly combined with the existing effective window area. Since these tests are empirically based, the tests already account for the additional heat gain associated with the elevated attic temperature and other surface temperatures.
US11921473B2
Apparatus, systems, articles of manufacture, and methods to generate acceptability criteria for autonomous systems plans are disclosed. An example apparatus includes a data compiler to compile data generated by the autonomous system into an autonomous system task dataset, a data encoder to encode the dataset for input into a rule distillation neural network architecture, a model trainer to train the rule distillation neural network architecture, an adaptor to adapt the trained rule distillation neural network architecture to a new input data domain using the autonomous system task dataset, a verifier to generate formally verified acceptability criteria, and an inferer to evaluate a control command, the evaluation resulting in an acceptance or rejection of the command.
US11921472B2
Apparatuses, methods, systems, and program products are disclosed to determine when a portable electronic device is moved within an enclosed space. A processor and memory may control a sensor may store code executable by the processor to measure a parameter at an inlet of the computing device. The parameter may include an airflow rate, an air temperature at the inlet, and/or a current supply to a fan of the computing device. The processor may execute code to determine when the parameter at the inlet reaches a threshold. When the processor determines that the measured parameter has reached the threshold, a signal from the sensor to the processor and/or from the processor to an operator may be sent, indicating that the threshold has been reached.
US11921470B2
A device with buttons includes: a display unit that is configured to perform predetermined display; and a plurality of buttons that are positioned on a lower side of the display unit. An area of a button to be most frequently used is the largest among areas of the plurality of buttons.
US11921465B2
An electronic watch including an exterior case including an opening, a crystal disposed in the opening, an hour hand and a minute hand that indicate the time of day, a dial including an indicium, a pressure sensor configured to measure a pressure, and a controller configured to determine a water depth based on the output from the pressure sensor, indicate the water depth with the hour hand, and indicate an elapsed time with the minute hand, the elapsed time being time elapsed after the predetermined water depth value is exceeded.
US11921463B2
The present disclosure includes a case body configured to accommodate a movement, and a rotating bezel attached to the case body. The rotating bezel includes a bezel body having an annular shape, and a display plate detachably attached to the bezel body. An engagement protrusion protruding toward the bezel body and being continuous in a circumferential direction is provided at the display plate. A plastic gasket having an annular shape is disposed between the bezel body and the engagement protrusion. A first recessed portion is provided in an outer circumference of the display plate. A second recessed portion is provided in the engagement protrusion of the display plate so as to correspond to a position of the first recessed portion.
US11921450B2
An image forming apparatus includes an image forming unit, a fixing unit, a varnish coater, and a controller. When a first image forming job in which a toner image is formed to a first recording material and varnish is not applied is executed, the controller controls conveyance of the first recording material at a fixing nip portion such that a conveyance speed of the first recording material at the fixing nip portion is a first conveyance speed. When a second image forming job in which a toner image is formed to a second recording material of which a grammage is the same as a grammage of the first recording material and varnish is applied is executed, the controller controls conveyance of the second recording material at the fixing nip portion such that the second recording material is conveyed at a second conveyance speed faster than the first conveyance speed.
US11921441B2
A developer supply container includes a developer discharging portion that is provided with a discharge passageway. A track is provided at a first side of the developer discharging portion. A shutter is provided with a shutter opening configured to permit discharge of the developer from the discharge passageway, with the shutter including a recessed portion on an outer side of the shutter. The recessed portion includes an inclined surface.
US11921437B2
A charging member may include a surface layer. The surface layer may include a urethane resin, an electron conducting agent, an azo-based metal complex compound, and a quaternary ammonium salt.
US11921436B2
A lithography system is provided with: a measurement device measuring position information of marks on a substrate held in a first stage; and an exposure apparatus on a second stage, the substrate for which the position information measurement for the marks has been completed, performs alignment measurement to measure position information for part of marks selected from among the marks on the substrate, and performs exposure. The measurement device measures position information of marks on the substrate to obtain higher-degree components of correction amounts of an arrangement of divided areas, and the exposure apparatus measures position information of a small number of marks on the substrate to obtain lower-degree components of the correction amounts of the arrangement of the divided areas and exposes the plurality of divided areas while controlling the position of the substrate by using the obtained lower-degree components and the higher-degree components obtained by the measurement device.
US11921435B2
A lithographic system for projecting an image onto a workpiece using radiation is provided. The lithographic system includes: a support structure for supporting a workpiece; a radiation source for providing radiation to project an image on the workpiece; a reticle positioned between the radiation source and the workpiece; and a mask positioned adjacent the reticle, the mask being configured to block radiation from the radiation source, the mask including a heat removal apparatus.
US11921432B2
The present invention relates to an optical system with a variable focal distance in a predetermined focal distance range, comprising two mirrors and a KB mechanical assembly having two supports adapted to support the mirrors one after the other along their main axis so as to form a propagation path. The system is characterized in that each mirror has a useful portion whose width and/or thickness is/are variable and selected according to said predetermined distance range, and in that, for each mirror, it further comprises a deformation mechanism adapted to generate a curvature of the corresponding mirror along its length to adjust the focal distance within said predetermined distance range.
US11921430B2
A lithography method to pattern a first semiconductor wafer is disclosed. An optical mask is positioned over the first semiconductor wafer. A first region of the first semiconductor wafer is patterned by directing light from a light source through transparent regions of the optical mask. A second region of the first semiconductor wafer is patterned by directing energy from an energy source to the second region, wherein the patterning of the second region comprises direct-beam writing.
US11921423B2
An imprint apparatus executes imprint processing of curing imprint material in a state in which the imprint material supplied onto a substrate and a mold are in contact with each other. The imprint apparatus includes a modulator configured to modulate incident light, a first optical system configured to guide first light from a first light source to the modulator, and second light from a second light source that has a wavelength different from that of the first light to the modulator, and a second optical system configured to guide modulated light modulated by the modulator to the substrate.
US11921418B2
A shutter and a photographing apparatus are provided. The shutter includes: a shutter base including an exposure opening; a shutter mechanism including a blade assembly and a synchronizer ring for driving the blade assembly, the synchronizer ring being movable between a first position and a second position, and the exposure opening being open when the synchronizer ring is in the first position and closed when the synchronizer ring is in the second position; and a braking member for decelerating the shutter mechanism. In the shutter and the photographing apparatus according to the present disclosure, the shutter mechanism may be buffered when the blade assembly closes the exposure opening of a camera, so as to prevent the shutter mechanism from being damaged.
US11921409B2
A light projector and method of aligning the light projector is provided. A light projector steers an outgoing beam of light onto an object, passing light returned from the object through a focusing lens onto an optical detector. The light projector may generate a light pattern or template by rapidly moving the outgoing beam of light along a path on a surface. To place the light pattern/template in a desired location, the light projector may be aligned with an electronic model.
US11921408B2
A projection device according to the present disclosure includes a light source unit, an image formation unit, a projection optical unit, and a housing which has a first surface and a second surface opposed to each other, and is configured to house the light source unit, the image formation unit, and the projection optical unit, wherein the first surface includes a first region, and a second region lower in height from the second surface than the first region, and a receiving part on which a suspending attachment is mounted is disposed in the second region.
US11921394B2
Layered dielectric materials for use in controlling dielectric strength in microelectronic devices, especially as they relate to electrophoretic and electrowetting applications. Specifically, a combination of a first atomic layer deposition (ALD) step, a sputtering step, and a second ALD step result in a layer that is chemically robust and nearly pinhole free. The dielectric layer may be disposed on the transparent common electrode of an electrophoretic display or covering the pixelated backplane electrodes, or both.
US11921393B2
Stable, macroscopic single-crystal chiral liquid crystal compositions are described. The compositions include a single-crystal chiral liquid crystal material on a patterned surface. The patterned surface seeds a particular crystallographic orientation at the substrate-liquid crystal interface. Also described are methods of forming the single-crystal chiral liquid crystal compositions.
US11921390B2
The present disclosure provides an array substrate, a manufacturing method thereof and a display device. The array substrate includes: a display area and a peripheral area surrounding the display area; the display area is provided with a plurality of gate lines and a plurality of data lines, the gate lines and the data lines are crossed to define a plurality of sub-pixel regions distributed in an array; a first electrode, the first electrode including a first portion located in the display area and a second portion located in the peripheral area; an electrode connection line, the electrode connection line is located in the peripheral area, the electrode connection line is electrically connected to the second portion; a plurality of compensation signal lines, at least part of the compensation signal lines are located in the display area, and the compensation signal lines are electrically connected to the first portion.
US11921388B2
Provided are an array substrate and a manufacturing method thereof, and a display device. The array substrate comprises a plurality of data lines and sub-pixels. At least one sub-pixel comprises: a first insulating layer; a gate; an active layer located on one side of the first insulating layer away from the gate; a pixel electrode; a first electrode located connected to the active layer and in contact with the pixel electrode; a second electrode connected to the active layer and a data line; a second insulating layer having a first opening, wherein the orthographic projection of the first opening partially overlaps with the orthographic projections of the pixel electrode and the first electrode; a connection electrode in contact with the pixel electrode and the first electrode through the first opening; and a common electrode located on one side of the second insulating layer away from the pixel electrode.
US11921387B2
Display panel having first scan lines and second scan lines connected in parallel and display device
The present invention provides a display panel and a display device using the display panel. By connecting a plurality of second scan lines in parallel, resistance between output terminals of chips on film (COF) and first scan lines are reduced, and differences between output resistances of the COF corresponding to different first scan lines are reduced, so differences between signals in different first scan lines are reduced, and uneven display problems in existing display panels are solved.
US11921386B2
According to one embodiment, a display device includes a display panel, a first wiring board mounted on the display panel, and a backlight unit located on a back surface side of the display panel to illuminate the display panel. The backlight unit includes a casing which includes a bottom plate including a first slit and a side plate standing at the bottom plate, and a light guide arranged in the casing. The first wiring board passes between the side plate and the light guide and through the first slit and is bent toward a back surface side of the casing.
US11921384B2
According to one embodiment, a light control device includes a first liquid crystal cell, a second liquid crystal cell, and a polarization conversion element disposed between the first liquid crystal cell and the second liquid crystal cell. One substrate of each of the first liquid crystal cell and the second liquid crystal cell includes an insulating substrate, and first to fourth electrodes arranged on the insulating substrate and formed in a strip shape. The electric potential difference between the first electrode and the second electrode, the electric potential difference between the second electrode and the third electrode, and the electric potential difference between the third electrode and the fourth electrode are different from each other.
US11921381B2
A display device includes: a plurality of pixel electrodes arranged in the display region of a first substrate; a color filter provided on a second substrate opposing the first substrate and overlapping the pixel electrode; a planarization insulating layer provided on the color filter; a common electrode provided on the planarization insulating layer and having an opening; a spacer arranged between the pixel electrode and the common electrode; and a light-shielding layer provided between the first substrate and the pixel electrode and overlapping the spacer.
US11921373B2
A backlight includes an extended light source adapted to emit light. A reflective polarizer is disposed on the extended light source, such that for substantially normally incident light and for at least a first wavelength in a range from about 420 nanometer (nm) to about 650 nm, the reflective polarizer reflects at least 60% of the incident light having a first polarization state and transmits at least 60% of the incident light having an orthogonal second polarization state. A first prismatic film is disposed between the extended light source and the reflective polarizer. A retarder layer is disposed between the reflective polarizer and the first prismatic film, such that for substantially normally incident light at a wavelength of about 550 nm, the retarder layer has a retardance nW, where n is an integer ≥1 and W is a wavelength between about 160 nm and about 300 nm.
US11921368B2
An electronic device may be provided with a display. The display may be overlapped by an antiglare film. The antiglare film may have a rough surface to diffuse incident light, thereby reducing glare. Additionally, the antiglare film may have a smooth portion that forms a transparent window and allows light to pass through undiffused. The electronic device may include a light-based component, such as a camera, that receives undiffused light through the transparent window. By overlapping the light-based component with the transparent window, the light-based component may receive the light in an unimpeded manner, thereby making more accurate measurements of the light. The display may have one or more display layers, such as opaque masking layers or polarizers, with openings that are aligned with the transparent window. The light-based component may receive the light through these openings so that the light is not absorbed or polarized before reaching the component.
US11921367B2
A switchable privacy display comprises a spatial light modulator with output polariser, a reflective polariser, a polar control liquid crystal retarder and an additional polariser. The electrodes of the polar control liquid crystal retarder are patterned with a mark. In wide angle and narrow angle operational modes, the electrodes of the liquid crystal retarder are driven such that the mark is not visible. In a mark display state, the electrodes are driven to provide visibility of the mark in reflected light to an off-axis observer.
US11921366B2
A multi core optical fiber that includes a plurality of cores disposed in a cladding. The plurality of cores include a first core and a second core. The first core has a first propagation constant β1, the second core has a second propagation constant β2, the cladding has a cladding propagation constant β0, and (I).
US11921360B2
Contact lenses, methods and systems for accomplishing the requirement for biocompatibility of oxygen delivery to the eye, and the cornea in particular, when elements and components are used which reduce the transmissibility of oxygen and which require coverage of a significant area of the non-vascularized cornea. A contact lens assembly is provided, comprising: an anterior surface, a posterior surface and at least one element or component having a substantially low oxygen permeability disposed within the lens. The contact lens also includes a layer having an oxygen permeability greater than the aforementioned element or component. The thickness of this layer is such that the layer provides an equivalent oxygen percentage to the cornea beneath the aforementioned element or component.
US11921357B2
Apparatuses, systems for electronic wearable devices such as smart glasses are described. The wearable device can comprise a frame, an elongate temple and an articulated joint. The frame can define one or more optical element holders configured to hold respective optical elements for viewing by a user in a viewing direction. The temple can be moveably connected to the frame for holding the frame in position when the device is worn by the user. The articulated joint can connect the temple and the frame to permit movement of the temple relative to the frame between a wearable position in which the temple is generally aligned with the viewing direction, and a collapsed position in which the temple extends generally transversely to the viewing direction. The articulated joint can include abase foot fixed to the frame and oriented transversely to the viewing direction.
US11921354B2
An electronic assembly including eyewear and/or an eyewear case having a support structure and a conductive contact surface supported by the support structure. The eyewear case includes electronic components, an electrical contact surface adapted to engage the conductive contact surface of the eyewear, a first magnet attached to the electrical contact surface, and a second magnet that is positioned to attract or repel the first magnet.
US11921353B2
An optical imaging system includes an optical system including at least six lenses, sequentially disposed from an object side toward an image side, an image sensor configured to convert light incident through the optical system into an electronic signal, and a variable stop configured to change an incident hole diameter and disposed toward the object side of a lens of the optical system closest to the object side, wherein TTL is a distance to an imaging plane of the image sensor from an object-side surface of the lens closest to the object side and 4.7 mm
US11921351B2
According to an embodiment, a mirror is attached to the gooseneck with a mounting bracket. The gooseneck attaches to a second mounting bracket that is affixed to the sewing machine. According to a further embodiment, optional magnets can be affixed to the back of the mirror, thus allowing the user to keep pins off the work surface (by attaching the pins to the back of the mirror).
US11921350B2
This invention provides a vision system having a housing and an interchangeable lens module is provided. The module is adapted to seat on a C-mount ring provided on the front, mounting face of the housing. The module is attached via a plurality of fasteners that pass through a frame of the module and into the mounting face. The module includes a connector in a fixed location, which mates with a connector well on the mounting face to provide power and control to a driver board that operates a variable (e.g. liquid) lens within the optics of the lens module. The driver board is connected to the lens body by a flexible printed circuit board (PCB), which also allows for axial motion of the lens body with respect to the frame. This axial motion can be effected by an adjustment ring that can include an indexed/lockable, geared, outer surface.
US11921346B2
Embodiments provide a lens moving apparatus including housing to support a driving magnet, a bobbin provided at an outer circumferential surface thereof with a coil located inside the driving magnet, the bobbin being moved in a first direction parallel to an optical axis within the housing via electromagnetic interaction between the driving magnet and the coil, a lower elastic member to connect a lower portion of the housing and a lower portion of the bobbin to each other, both ends of the coil being electrically connected to the lower elastic member, the lower elastic member having a first terminal electrically connected to an external power source so as to supply external power to the ends of the coil, and a printed circuit board provided at one side surface of the housing, the printed circuit board having a second terminal electrically connected to the external power source.
US11921339B2
An optical distribution and splice frame system includes rack(s), enclosure(s), cable management component(s), and/or cassette(s) that have features to allow for different cable management configurations not yet available in the market. A fiber optic cassette and enclosure are designed to enable flexibility in cable management configurations for the overall system.
US11921334B2
An alignment structure of optical element is provided, including: an optical fiber, having a parallel fiber segment and a plurality of bare fiber segments; a cover plate, provided with a plurality of side-by-side guide grooves and a plurality of first coupling parts, the bare fiber segments of the optical fiber being arranged in the corresponding guide grooves, cross-sectional shapes of the guide grooves being at least one of U-shaped or V-shaped; and a silicon chip, provided with lines and a plurality of second coupling parts; when the cover plate is matched with the silicon chip, the first coupling parts and the second coupling parts being coupled and positioned with each other respectively, and the optical fiber being fixed between the silicon chip and the cover plate. As such, precise positioning and rapid assembly are achieved.
US11921328B2
A head assembly of optical fiber connector comprises a guiding head, a terminal base, an elastic element, a tube body, and a stopping element. The guiding head has a fiber channel for receiving optical fiber. The terminal base has a front base body and the rear base body, wherein the front base body is utilized for accommodating an end portion of the guiding head. The elastic element is utilized to accommodate with the terminal base. The tube body has an accommodation space for accommodating with the terminal base. The stopping element is arranged into the tube body, and has a through hole allowing the rear base body passing therethrough, wherein a second end of the elastic element is leaned against the stopping element. The present invention further provides a protection cap for protecting the head assembly from being damaged and contaminated.
US11921327B2
A cable management arrangement (1000) is disclosed. In one aspect, a plurality of cables (1002) extending between first and second ends is provided. The arrangement (1000) can also include a supporting sheet (1004) having a first side and a second side, wherein the plurality of cables (1002) is removably adhered to the supporting sheet first side by a first adhesive (1010). A second adhesive (1012) can be provided on at least a portion of the supporting sheet second side and a protection sheet (1014) can be provided to cover the second adhesive (1012). A protection sheet (1014) can be provided that is removable from the supporting sheet (1004) to allow the supporting sheet (1004) to be adhered to a surface. A telecommunications arrangement is also disclosed in which the aforementioned cable management arrangement (1000) is mounted to a telecommunications tray (112) via the second adhesive (1012).
US11921325B2
A semiconductor device is provided. The semiconductor device includes a waveguide over a substrate. The semiconductor device includes a first dielectric structure over the substrate, wherein a portion of the waveguide is in the first dielectric structure. The semiconductor device includes a second dielectric structure under the waveguide, wherein a first sidewall of the second dielectric structure is adjacent a first sidewall of the substrate.
US11921311B2
Provided is a lighting apparatus having high light entrance efficiency with respect to a light guide plate, and being excellent in tint of light emitted from the light guide plate. The lighting apparatus of the present invention includes: an LED package; a light guide plate, which includes a main surface serving as a light emission surface, and a side surface serving as a light entrance surface, and which is arranged so that the side surface is opposed to the LED package; and a low-refractive index layer arranged between the LED package and the light guide plate.
US11921307B2
The present disclosure provides an optical element driving mechanism, which includes a movable part, a fixed assembly, and a driving assembly. The movable part is configured to be connected to an optical element. The movable part is movable relative to the fixed assembly. The driving assembly is configured to drive the movable part to move relative to the fixed assembly. The movable part includes a connecting assembly configured to position the optical element.
US11921305B2
A retroreflective sign comprising a rigid substrate with a pattern of cell walls formed of a polyurethane adhesive or two-part polyurea adhesive, and a polymeric sheet having a front face and a rear face, the rear face facing the substrate, the rear face comprising microprismatic reflective elements is disclosed. The polymeric sheet is adhered directly to the cell walls formed of the polyurethane adhesive or two-part polyurea adhesive while leaving an air gap between the microprismatic retroreflective elements and the rigid substrate in the cells. A method of making the retroreflective sign includes applying a polyurethane adhesive or two-part polyurea adhesive to a front side of a rigid substrate in a pattern defining cell walls; and prior to full curing of the polyurethane adhesive, laminating the front side of the rigid substrate a rear side of a polymeric sheet via the cell walls, the polymeric sheet comprising microprismatic elements.
US11921298B2
A spot-size converter includes first and second waveguide structures. The first waveguide structure extends longitudinally along a waveguide axis from a first end to a second end and is configured to support a first optical mode at the first end. The second waveguide structure is formed within the first waveguide structure. The second waveguide structure extends longitudinally between the first end and the second end. The second waveguide structure is configured to support a second optical mode at the second end. The second optical mode has a different diameter than the first optical mode. The second waveguide structure includes a waveguide core that has a first cross-sectional area in a first plane normal to the waveguide axis at the first end and a second cross-sectional area in a second plane normal to the waveguide axis at the second end. The second cross-sectional area is larger than the first cross-sectional area.
US11921293B2
A head-mounted display comprises: a wearing body; a display; a communication module configured to perform communication connection with a mobile information terminal; a field of view (FOV) sensor configured to output status data used for determining whether the mobile information terminal is included in a user's FOV through the wearing body; and a controller connected to each of the display, the communication module, and the FOV detection sensor. The controller determines whether the mobile information terminal is included in the user's FOV based on the status data, and performs display control with respect to the display so as to display an application screen of the mobile information terminal on the display when determining that the mobile information terminal is not included in the FOV, and not to display the application screen on the display when determining that the mobile information terminal is included in the FOV.
US11921291B2
In an example method of training a neural network for performing visual odometry, the neural network receives a plurality of images of an environment, determines, for each image, a respective set of interest points and a respective descriptor, and determines a correspondence between the plurality of images. Determining the correspondence includes determining one or point correspondences between the sets of interest points, and determining a set of candidate interest points based on the one or more point correspondences, each candidate interest point indicating a respective feature in the environment in three-dimensional space). The neural network determines, for each candidate interest point, a respective stability metric and a respective stability metric. The neural network is modified based on the one or more candidate interest points.
US11921289B2
A personal display device for displaying virtual images to a wearer. The personal display device includes a frame having a right temple section, a left temple section, a right rear section, a left rear section, a right eye see-through section, and a left eye see-through section; a projection display device connected to the frame for projecting an image to the wearer; at least one waveguide stack module connected to the frame for propagating image-bearing light beams along a length of the at least one waveguide stack module, the at least one waveguide stack module being configured to receive the image from the projection display device and detected touch motions of the wearer sensed by the touchpad including sensing directions of the touch motions of the wearer.
US11921285B2
Method and system for on-chip processing to obtain an EDOF image combines interferometry and imaging so the two operations do not interfere with one another but, rather, work together to create an in-focus, true color image of a three-dimensional object. This image has no significant artifacts and requires only limited processing. In addition, a coarse depth map is created in the process which may also be helpful in subsequent usage of the acquired image. A CMOS pixel-array sensor includes circuitry to implement processing at the pixel level.
US11921271B2
Provided herein is a macroscope comprising an objective apparatus comprising a multifocal widefield optics comprising a plurality of optical components configured to focus on a plurality of planes. Also provided herein are methods for analyzing a three-dimensional specimen, the method comprising obtaining, via a macroscope, synchronous multifocal optical images of a plurality of planes of the three-dimensional specimen, wherein the macroscope comprises an objective apparatus comprising a multifocal widefield optics comprising a plurality of optical components configured to focus on a plurality of planes. The three-dimensional specimen can be a biological specimen, such as brain.
US11921270B2
An inspection system includes a main support die configured to receive a target specimen; an auxiliary support die adjacent to the main support die and configured to receive a reference specimen; a cleaning device configured to remove contaminants from the reference specimen; an objective lens unit configured to direct light to main support die from a light source adjacent to the objective lens unit; a spectroscope between the objective lens unit and the light source; a detector adjacent to the objective lens unit; an imaging device between the objective lens unit and the detector; and a computer system in communication with the detector.
US11921263B2
An optical imaging lens includes first, second, third, fourth, fifth, and sixth lens elements, disposed sequentially from an object side to an image side, each of the lens elements having an object-side surface facing toward the object side and an image-side surface facing toward the image side. The image-side surface of the first lens element comprises a concave portion in a vicinity of an optical axis. The object-side surface of the third lens element comprises a concave portion in a vicinity of a periphery of the third lens element. The object-side surface of the fourth lens element comprises a concave portion in a vicinity of the optical axis. The lens elements of the optical imaging lens as a whole are only the six lens elements.
US11921259B2
An electronic device includes electrical components in a housing. The components may include optical components such as a display. Protective structures may be used to protect the optical components. The protective structures may include one or more protective transparent layers such as layers of glass or crystalline material such as sapphire. The protective transparent layers may be coated with an oleophobic coating. To enhance coating durability, catalyst may be used to help bond the oleophobic coating. An adhesion promotion layer such as a silicon oxide layer may be deposited on the transparent protective layer. A catalyst layer such as a layer of sodium fluoride may be deposited on the adhesion promotion layer. The oleophobic material may be evaporated or otherwise deposited on the catalyst layer. Heat and moisture may help the oleophobic material form chemical bonds with the adhesion promotion layer, thereby forming a durable oleophobic coating.
US11921248B2
A pressure wave is generated within a first well extending into a subterranean formation. A pressure response associated with the pressure wave is detected from a second well extending into the formation. Information is then determined, based on the pressure response in the second well, wherein the information is associated with at least one of the formation and a fracture connected to at least one of the first well and the second well.
US11921237B2
An example circuit includes a light detector and a biasing capacitor having (i) a first terminal that applies to the light detector an output voltage that can either bias or debias the light detector and (ii) a second terminal for controlling the output voltage. The circuit includes a first transistor connected to the second terminal of the biasing capacitor and configured to drive the output voltage to a first voltage level above a biasing threshold of the light detector and thereby biasing the light detector. The circuit includes a second transistor connected to the second terminal of the biasing capacitor and configured to drive the output voltage to a second voltage level below the biasing threshold of the light detector and thereby debiasing the light detector. The second voltage is a non-zero voltage that corresponds to a charge level of the biasing capacitor.
US11921236B1
A light detection and ranging (lidar) system for a vehicle may include an input optical path, a first optical path, a plurality of second optical paths, a first optical amplifier, and a plurality of second optical amplifiers. The input optical path may be configured to receive a beam from a laser source. The first optical path and the plurality of second optical paths may be respectively branched from the input optical path. The first optical amplifier may be coupled to the first optical path and configured to output a local oscillator (LO) signal. The plurality of second optical amplifiers may be respectively coupled to the plurality of second optical paths, one of the plurality of second optical amplifiers being selectively turned on to modulate the beam received through a second optical path and output a modulated optical signal of the beam.
US11921231B2
A method and a device for monitoring a region (R) in which a carrier (100) is located, which device comprises a display unit displaying a polar plot (10) having a center symbolizing the current position of the carrier (100) and in which there is placed a first moving-body symbol (1, 2, 3) representing the current position of the moving body (101, 102, 103); the polar plot (10) being surrounded by an annular band (20) of width (l) representing a predetermined monitoring duration and containing second moving-body symbols (1′, 2′, 3′) representative of successive angle readings of the path of said moving body (101, 102, 103).
US11921229B2
An apparatus, including processing unit (PU) cores and computer readable storage devices storing machine instructions for determining a distance between a target object and a radar sensor circuit. The PU cores receive a beat signal generated by the radar sensor circuit and compensate for a phase difference between the received beat signal and a reconstruction of the received beat signal to obtain a phase compensated beat signal. The phase compensated beat signal is then filtered to remove spurious reflections by demodulating the phase compensated beat signal using an estimated frequency of the phase compensated beat signal. The PU cores then apply a low pass filter to the demodulated phase compensated beat signal, resulting in a modified beat signal. The PU cores then determine the distance between the target object and the radar sensor circuit using the modified beat signal.
US11921224B2
A system includes at least one sensing unit, the sensing unit including a sensing element. The system includes at least one spatial Lorentz filter coupled to the sensing element. The spatial Lorentz filter (SLF) includes an input coupled to the sensing element and an analog to digital converter (ADC) providing a filtered output signal. The sensing unit is connected to a processor configured for determining velocity or position with respect to a magnetic field and/or a geographic position by processing SLF output signals.
US11921216B2
An electronic apparatus is provided. The electronic apparatus according to the disclosure includes: a light emitter; a light receiver; a memory; and a processor, wherein the processor is configured to: acquire a first depth image based on first reflected light acquired during a first time period and store the first depth image in the memory, acquire a second depth image based on second reflected light acquired during a second time period following the first time period, and acquire distance information between the electronic apparatus and the object included in the second depth image by subtracting a first depth value of each pixel of the first depth image from a second depth value of each pixel of the second depth image, and correct the distance information by using a compensation value acquired based corresponding to time information on the second time period.
US11921213B2
Examples disclosed herein relate to an autonomous driving system in a vehicle having a radar system with a Non-Line-of-Sight (“NLOS”) correction module to correct for NLOS reflections prior to the radar system identifying targets in a path and a surrounding environment of the vehicle, and a sensor fusion module to receive information from the radar system on the identified targets and compare the information received from the radar system to information received from at least one sensor in the vehicle.
US11921207B2
A light detection and ranging system arranged to scan a scene is provided. A light source outputs light having a first characteristic. A spatial light modulator receives output light from the light source and outputs spatially-modulated light in accordance with computer-generated holograms represented thereon. A light detector receives light having the first characteristic from the scene and outputs a light response signal. A holographic controller is arranged to output a plurality of computer-generated holograms to the spatial light modulator. Each computer-generated hologram is arranged to form structured light having a corresponding pattern within the scene. The holographic controller is further arranged to change the pattern of the structured light formed by at least one of the plurality of computer-generated holograms.
US11921205B2
An optical sensing system and a method for eliminating misjudgment of a reflective light are provided. The optical sensing system includes a first light source, a second light source, a light sensor, and a processor. The processor is configured to: control the first light source to scan a horizontal detection area; control the light sensor to capture a first frame by receiving first reflective lights from the horizontal detection area; obtain a first reflection pattern, and analyze the first reflection pattern to determine whether an object is within the first portion; if so, control the second light source to scan a first vertical detection area; control the light sensor to capture a second frame from the first vertical detection area; process the second frame to obtain a second reflection pattern, and analyze the second reflection pattern to determine whether the object is detected by a misjudgment.
US11921203B2
A system, method and mirror are provided in order to more reliably detect the presence of an object, such as a person. In the context of a system, the system includes a sensor configured to emit signals having a predefined wavelength and to detect a reflection of the signals having the predefined wavelength. The system also includes a reflective surface positioned relative to the sensor such that the signals emitted by the sensor are directed toward the reflected surface. The system further includes a filter associated with the reflective surface and positioned relative to the sensor such that the signals emitted by the sensor are also directed toward the filter. The filter is configured to attenuate at least signals having the predefined wavelength.
US11921198B2
An apparatus determines a spatial position of an audio source in multi moving audio sources scenarios. The apparatus receives audio signal versions as local sound waves. The apparatus determines first and second probabilities for a direction of arrival of the audio signal version based on the audio signal versions received within a first time interval; determines third and fourth probabilities for the direction of arrival of the audio signal version based on the audio signal versions received within a second time interval; determines a first probability difference between the first and third probabilities; determines a second probability difference between the second and fourth probabilities; combines the third probability and the first probability difference to obtain an updated third probability; combines the fourth probability with the second probability difference to obtain an updated fourth probability; and determines the spatial position based on the updated third and fourth probabilities.
US11921194B2
A radar anti-spoofing system for an autonomous vehicle includes a plurality of radar sensors that generate a plurality of input detection points representing radio frequency (RF) signals reflected from objects and a controller in electronic communication with the plurality of radar sensors. The one or more controllers execute instructions to determine a signal to noise ratio (SNR) distance ratio for the input detection points generated by the plurality of radar sensors, where a value of the SNR distance ratio is indicative of an object being a ghost vehicle. The one or more controllers also determine an effective particle number indicating a degree of particle degradation for the importance sampling for each variable that is part of the state variable. In response to determining the effective particle number is equal to or less than a predetermined threshold, the one or more controllers estimate a ghost position for the ghost vehicle.
US11921190B2
A system for tracking multiple projectiles includes a first radar device aimed so that a field of view of the first radar device covers at least a portion of a target area into which projectiles are to be launched from a plurality of launch locations and a processor receiving data from the radar and identifying from the data tracks of a plurality of projectiles. The processor determines for each projectile track identified a specific one of the launch locations from which the projectile was launched and provides to the launch location associated with each projectile data corresponding to a trajectory of the projectile.
US11921187B1
Techniques for monitoring devices to use ultrasonic signals to detect and track the locations of moving objects in an environment. To determine distance information, the monitoring devices emit a frequency-modulated continuous wave (FMCW) signal at an ultrasound frequency range. Reflections of the FMCW ultrasonic signal are used to generate time-of-arrival (TOA) profiles that indicate distances between the monitoring device and objects in the environment. The reflections can be processed to suppress undesirable interferences, such as reflections off non-mobile objects in the environment (e.g., walls, furniture, etc.), vibrations off the floorings or the ceilings, etc. After processing the reflections, a heatmap can be used to plot the intensity of the reflections for the different TOAs of the reflections, and depict the movement of the user over time. Finally, a Kalman filter is used to smooth the peaks in the intensity values on the plot, and determine the trajectory of the human.
US11921185B2
An ultra-wideband (“UWB”) communication system comprising a transmitter and a receiver having two antennas. An UWB signal transmitted by the transmitter is received at each of the antennas. By comparing the carrier phases of the received signals, the phase difference can be determined. From this phase difference and the known distance, d, between the antennas, the Cartesian (x, y) location of the transmitter relative to the receiver can be directly determined.
US11921173B2
A method of determining an orientation α,β of a magnet which is pivotable about a reference position having a predefined position relative to a semiconductor substrate, comprising: a) determining at least two of the following magnetic field gradients: i) a first magnetic field gradient dBx/dx; ii) a second magnetic field gradient dBy/dy; iii) a third magnetic field gradient dBz/dx; iv) a fourth magnetic field gradient dBz/dy; b) determining a first angle α based on at least one of the magnetic field gradients; c) determining a second angle β based on at least one of the magnetic field gradients. A sensor device is configured for performing this method. A sensor system includes such sensor device and a magnet, optionally connected to a joystick.
US11921171B2
A magneto-inductive DC magnetometer is provided that is operable to output fluxgate quality measurements in a low mass, volume, power and cost package. The magnetometer enables constellation-class missions not only due to its low-resource requirements, but also due to its potential for commercial integrated circuit fabrication. In addition, the magnetometer will be part of a ground-based Space Weather Underground Citizen Science instrument package that enables dense arrays of space weather-relevant observations at mid-latitudes. The magneto-inductive operating principle is based on a simple resistance-inductor (RL) circuit and involves measurement of the time it takes to charge and discharge the inductor between an upper and lower threshold by means of a Schmitt trigger oscillator. This time is proportional to the inductance that in turn is proportional to the field strength.
US11921163B2
Approaches, techniques, and mechanisms are disclosed for assessing battery states of batteries. According to one embodiment, raw sensor data are collected from a battery module. The battery module includes multiple battery cells. Input battery features are extracted from the raw sensor data collected from the battery module. The input battery features are used to update node states of a GNN. The GNN include multiple GNN nodes each of which representing a respective battery cell in the multiple battery cells. Estimation of one or more battery state of health (SoH) indicators is generated based at least in part on individual output states of individual GNN nodes in the multiple GNN nodes. The individual output states of individual GNN nodes in the multiple GNN nodes are determined based at least in part on the updated node states of the GNN.
US11921160B2
Sensor data relating to operating conditions for an integrated circuit are read out through scan chains. Scan tests are run on an integrated circuit containing logic circuits that implement logic functions. The logic circuits are interconnected to form scan chains which are used in running the scan tests. The scan test data resulting from the scan tests is read out from the logic circuits through these scan chains. During the scan tests, sensor blocks capture measurements of the operating conditions for the logic circuits. The operating conditions may include process, voltage and/or temperature conditions, for example. The sensor blocks are also interconnected to form one or more scan chains, and sensor data produced from the captured measurements is read out through these scan chains concurrently with the read out of the scan test data.
US11921158B2
Disclosed is a fan-out buffer which includes a first channel that includes a first delay circuit adjusting a first delay time of a calibration test signal depending on a first delay control signal, a second channel that includes a second delay circuit adjusting a second delay time of the calibration test signal depending on a second delay control signal, a first edge-to-pulse converter that detects a first edge included in a first time domain reflectometry (TDR) waveform of an output terminal of the first channel and generates a first start pulse signal including a first pulse, a second edge-to-pulse converter that generates a second start pulse signal including a second pulse, a stop pulse signal generator that generates a stop pulse signal including a first stop pulse, and a first delay control signal generator that calculates a phase difference generates the first delay control signal.
US11921155B2
A dice testing method is provided. The dice testing method is used to determine which test data of test items can be explained by test data of other test items based on statistical analysis. After the test items with the test data that can be explained by the test data of the other test items are found out, corresponding dices will not be tested for those test items.
US11921150B2
An electric circuit arrangement to determine a level of an excess bias voltage of a single photon avalanche diode comprises an evaluation circuit being configured to determine a level of an excess bias voltage of the single photon avalanche diode in dependence on a signal course of an output signal of the single photon avalanche diode. In a first operational cycle of the circuit arrangement a voltage jump to the level of the excess bias voltage is generated at an output terminal, when a photon hits a photosensitive area of the single photon avalanche diode. In a subsequent second operational cycle, the output terminal of the single photon avalanche diode is coupled to a supply terminal.
US11921146B2
A method of detecting a fault in a power distribution system includes placing a signal on the system at a frequency F1 and then detecting a change in the signal due to a change in the impedence of the system as a result of a fault wherein the change is one of a change in phase, a change in signal tone, or a change in voltage level at the load. In one embodiment, band reject filters can be used to diminish the signal at the load or source. In another embodiment, the power source can be a periodic pulsed power source and the signal can be placed on the system during an idle phase of the periodic pulsed power.
US11921141B2
A graphene-based broadband radiation sensor and methods for operation thereof are disclosed. The radiation sensor includes an electrical signal path for carrying electrical signals and one or more resonance structures connected to the electrical signal path. Each resonance structure includes a resonator having a resonant frequency. Each resonance structure also includes a graphene junction connected in series with the resonator, the graphene junction including a graphene layer and having an impedance that is dependent on a temperature of the graphene layer. Each resonance structure further includes a heating element that is thermally coupled to the graphene layer and is configured to receive an incident photon, where the temperature of the graphene layer increases in response to the heating element receiving the incident photon.
US11921138B2
An insulation resistance detection device detects a voltage at a connection point between a coupling capacitor and a resistance in the case where a frequency signal is outputted to the resistance, and detects an insulation resistance between a ground portion and a power supply path based on a moving average value of a detection voltage. The insulation resistance detection device includes a first determination unit, a resistance detection unit, and a second determination unit. In response to a determination that the pulsation of the detection voltage is attenuated, the resistance detection unit detects the insulation resistance based on, instead of a first moving average value, a second moving average value calculated by using the detection voltage in a second range including a smaller number of detection voltages than in the first range.
US11921133B2
A testing head apt to verify the operation of a device under test integrated on a semiconductor wafer includes a plurality of contact elements, each including a body that extends between a first end portion and a second end portion, and a guide provided with a plurality of guide holes apt to house the contact elements. The guide includes a conductive portion that includes and electrically connects the holes of a group of guide holes to each other and is apt to contact a corresponding group of contact elements apt to carry a same type of signal.
US11921123B2
A quantitative detection method of rare earth doped calcium phosphate fluorescent nanoparticles (RE-nCaP) in organisms includes establishing a fluorescent intensity-concentration standard curve of rare earth ions, preparing samples to be tested and the blank control group into homogenate, performing centrifuging and testing the fluorescent intensity of supernatants, calculating the fluorescent intensity values per unit mass or volume of the samples and the blank control group, and performing significant difference analysis; if P is greater than or equal to 0.05, determining that the RE-nCaP content in the samples is 0, and if P is smaller than 0.05, testing the tissue extraction rate of RE-nCaP; and comprehensively considering the tissue extraction rate, the homogenate volume, the fluorescent intensity value per until mass or volume, the homogenate dilution ratio, and the doping amount to obtain the accurate content of the RE-nCaP in biological tissue samples.
US11921121B2
A method for determining the biological age or pace of aging of an adult dog, said method comprising determining the levels of one or more biomarkers selected from the group consisting of (1) blood globulin levels, (2) blood total protein, (3) blood alkaline phosphatase, (4) blood platelet count, (5) blood mean corpuscular volume or (6) urine specific gravity, comparing the results with values obtained from healthy dogs of a known age and of a similar category (toy, small, medium, large or giant). Kits, systems and/or computer media for carrying out the method form further aspects of the invention.
US11921109B2
Microfluidic devices for use with reagents bound to microspheres for determination of the concentration of an analyte in a liquid sample are provided. The devices include two sequential mixing channels that promote rapid binding of microsphere-bound reagents with reagents in solution and a means for detecting labeled microsphere-bound reaction products. Also provided are methods for using the devices with microsphere-bound reagents to determine the concentration of an analyte in a liquid sample and to measure the binding affinity of antibody for an antigen.
US11921108B2
A method for determining an amount of functional albumin includes providing a test sample containing a defined amount of albumin of unknown binding capacity and a reference sample containing the same defined amount of albumin having a reference binding capacity, incubating the test and reference samples with a defined amount of at least one albumin-binding marker M under conditions that allow formation of complexes of the at least one albumin-binding marker M and albumin (M:A), removing the complexes, detecting a presence or an amount of unbound marker M in the samples after removal of the complex (M:A) through a first and a second test strips that allow for a determination of an amount of unbound marker M, and determining the amount of functional albumin based on the presence or the amount detected of marker M.
US11921100B2
A system for locating and tracking an object is provided. The system includes a measuring device configured to determine a property of a paving-related material, a locating device configured to determine a location of the measuring device, a tracking system configured to store tracking information associated with the measuring device and one or more properties determined by the measuring device, and a communications system configured to transfer, to a remote device, the location of the measuring device and the tracking information associated with the measuring device.
US11921099B2
A method for quantitatively analyzing the reservoir formation of an ultra-deep evaporite-dolomite paragenesis system is performed as follows. A typical drilling core containing the evaporite-dolomite paragenesis system and a field section are observed. The logging data is subjected to single-factor analysis to determine the planar distribution regularity of the ultra-deep evaporite and the dolomite, and the analysis of sedimentary combination pattern and development evolution regularity is performed. The diagenetic system is determined, and the reservoir formation of the evaporite-dolomite paragenesis system is analyzed. Based on the above technical solutions, the property, the evolution path and the reservoir formation of sedimentation-diagenesis fluids in the evaporite-dolomite paragenesis system can be clarified.
US11921092B2
A vial supply system is provided with: a sampler configured to supply a vial to a predetermined supply destination by a transport arm; a management device communicatively connected to the sampler, the management device being configured to manage a supply operation of the vial by the sampler; and a display device provided so as to be able to communicate with the management device. When a teaching mode for performing teaching for setting a position of a transport arm at the time when a transport arm of the sampler transports the vial to and from the supply destination is started, the management device is configured to cause the display device to display an operation to be performed by a user in the teaching.
US11921087B2
Described herein are examples of improved material (and/or universal) testing machines having a lower crossbeam that may be moved via a drive system of the material testing machine. In some examples, this may be accomplished via drive shafts with different threading in upper and lower portions, and/or independent drive systems for upper and lower crossbeams. The ability to dynamically adjust (e.g., raise) the lower crossbeam may allow an operator to interact with test samples at a more comfortable height, and reduce the need for an operator to repeatedly bend and/or kneel.
US11921084B2
A method and system for inspecting a steel wheel or steel rim of an off the road vehicle is provided. A method and system for predictive modeling of health and remaining useful life of a steel wheel or steel rim of the off the road vehicle is also provided. The off the road vehicles include vehicles at remote locations such as mine sites.
US11921079B2
A gas sensor sensing a sensing target gas component contained in a measurement gas and identifying concentration of the sensing target gas component includes: a sensor element having an inlet for the measurement gas on one end portion, and including: an element base made of an oxygen-ion conductive solid electrolyte; a heater buried in the element base; and a porous leading-end protective layer covering a predetermined range of the element base on the one end portion; and a metallic member within which the sensor element is fixedly disposed, wherein a minimum distance between the sensor element and an inner surface of the metallic member is 0.20 mm or more and 0.95 mm or less, and a portion of the inner surface of the metallic member closest to the sensor element has an arithmetic average roughness of 5 μm or less.
US11921078B2
A sensor element includes an element body and a porous protective layer arranged to cover a part of a surface of the element body. The protective layer includes an inlet protective layer arranged to cover a gas inlet formed in the surface of the element body, and at least a part of a face included in the surface of the element body, the face on which the gas inlet is opens, and an arithmetic average roughness Rap of an inner peripheral surface of an internal space of the inlet protective layer satisfies at least one of conditions below: the arithmetic average roughness Rap is 8 μm or more, and the arithmetic average roughness Rap is higher than an arithmetic average roughness Rac of a bonding surface of the protective layer, the bonding surface at which the protective layer is bonded to the element body.
US11921077B2
An all-electronic high-throughput detection system can perform multiple detections of one or more analyte in parallel. The detection system is modular, and can be easily integrated with existing microtiter plate technologies, automated test equipments and lab workflows (e.g., sample handling/distribution systems). The detection system includes multiple sensing modules that can perform separate analyte detection. A sensing module includes a platform configured to couple to a sample well. The sensing module also includes a sensor coupled to the platform. The sensing module further includes a first electrode coupled to the platform. The first electrode is configured to electrically connect with the sensor via a feedback circuit. The feedback circuit is configured to provide a feedback signal via the first electrode to a sample received in the sample well, the feedback signal based on a potential of the received sample detected via a second electrode.
US11921075B2
A system includes a polymer bag, a fluid network, a saturation block, and a wick. The polymer bag has a sealed envelope and a fitment. The fluid network is coupled to the fitment. The saturation block has a fluid inlet coupled to the fluid network and has a wick chamber. The wick is configured for disposition in the wick chamber.
US11921074B2
In accordance with an embodiment, a gas-sensitive device includes a substrate structure, and a gas sensitive capacitor. The gas sensitive capacitor a first capacitor electrode in form of a gas-sensitive layer on a first main surface region of an insulation layer, and a second capacitor electrode in form of a buried conductive region below the insulation layer, so that the insulation layer is arranged between the first and second capacitor electrode. The gas-sensitive layer comprises a sheet impedance which changes in response to the adsorption or desorption of gas molecules.
US11921073B2
A fluid sensor includes a tuning fork mechanical resonator including a base and a tine projecting from the base along a longitudinal direction of the tine, and a pair of electrodes disposed on the tine. The base and the tine are formed from a piezoelectric material including lithium tantalate. The electrodes are exposed to a fluid.
US11921068B2
In a first step, a sample liquid is fabricated by mixing a sample formed of a polyester or decomposition products of a polyester into a solvent. The solvent used here contains chloroform and 2,2,2-trifluoroethanol and has an organic base added thereto. The organic base is at least one of a primary amine, a secondary amine, a tertiary amine and a heterocyclic amine. Next, in a second step, each of the amount of the terephthalic acid terminal and the amount of the hydroxy group terminal in the sample liquid is measured through a nuclear magnetic resonance spectroscopy aiming at hydrogen atoms. Subsequently, in a third step, the number average molecular weight of the sample is calculated from the amount of the terephthalic acid terminal and the amount of the hydroxy group terminal measured in the second step.
US11921061B2
An orientation degree distribution analysis method includes steps of: inputting, to a main storage device, crystal structure information of an object to be measured, information on an intensity ratio of each diffraction peak and a crystal plane corresponding to each diffraction peak by X-ray diffraction measurement, information on a diffraction range and a diffraction sensitivity, and information on an intensity ratio of each diffraction peak of a randomly oriented sample; calculating an angle defined by an orientation plane and a crystal plane corresponding to a diffraction peak of interest from the information stored in the main storage device; calculating an existence ratio and storing the existence ratio in the main storage device; setting an orientation degree distribution function; and calculating an orientation degree distribution from the information of the inputting step and the information of the calculating step.
US11921058B2
A computer-tomography (CT) imaging system, comprising an imaging data acquisition system. The imaging data acquisition system includes a plurality of sets of a detector section, a storage section, and an aggregation section. The detector section includes a plurality of detector elements each being configured to convert radiation into electric signals. The aggregation section is configured to aggregate imaging data carried by the electronic signals from the detector section. The storage section is connected with an output of the detector section and an input of the aggregation section. The storage section comprises a predetermined number of non-volatile memories to store the imaging data from the corresponding detector elements.
US11921052B2
An inspection system may generate first-step images of multiple sample regions after a first process step and generate second-step images of the sample regions after a second process step, where the second process step modifies the sample in at least one of the sample regions. The system may further identify one of the sample regions as a test region and at least some of the remaining sample regions as comparison regions, where the second-step image of the test region is a test image and the second-step images of the comparison regions are comparison images. The system may further generate a multi-step difference image by subtracting a combination of at least one of the second-step comparison images and at least two of the first-step images from the test image. The system may further identify defects in the test region associated with the second process step based on the multi-step difference image.
US11921051B2
Provided herein is an apparatus for assessing a color characteristic of a gemstone. The apparatus comprises an optically opaque platform for supporting a sample gemstone to be assessed, a daylight-approximating light source to provide uniform illumination to the gemstone, an image capturing component, and a telecentric lens positioned to provide an image of the illuminated gemstone to the image capturing component. Also provided are methods of color analysis based on images collected using such an apparatus.
US11921050B2
A method for predicting risk of a future disease condition includes the steps of collecting and transporting bodily fluid to at least one colorimetric analyte sensing element, detecting the presence of bodily fluid, collecting optical data relating to the at least one colorimetric analyte sensing element with at least one spectrophotometer after a predetermined time period after detecting the presence of bodily fluid in contact with the colorimetric analyte sensing element, communicating the optical data to a computing system having at least one processor and data storage, analyzing the optical data to determine at least one analyte concentration in the bodily fluid, identifying a threshold analyte concentration of the at least one analyte in the bodily fluid that is an indicator of the risk of developing a future disease condition; and recording the at least one analyte concentration in the bodily fluid over time.
US11921044B2
An inspection arrangement for fluorescence-based inspection of a product containing at least one fluorophore having an excitation spectrum and an emission spectrum, the inspection arrangement including a radiation source for generating a first electromagnetic radiation in a first wavelength range containing an excitation spectrum and a second electromagnetic radiation in a second wavelength range containing the emission spectrum, an imaging device for generating images of an inspection area in which the product can be arranged, and an image data processing device for image processing of the images. The inspection arrangement captures with the imaging device at least one fluorescence image of the inspection area irradiated with the first electromagnetic radiation and at least one reference image of the inspection area irradiated with the second electromagnetic radiation. The image data processing device generates a correction image based on the at least one fluorescence image and the at least one reference image.
US11921043B2
A fluorescence observation device is a device for performing fluorescence observation of a sample piece cut out from a sample including: a tray on which the sample piece is placed; a light source unit which generates excitation light to irradiate the sample piece; a detection unit which detects fluorescence from the sample piece; and an image generation unit which generates a fluorescence image of the sample piece based on a detection signal from the detection unit and the tray includes a plurality of placement regions provided around a center region of the tray and also includes a marker portion indicating a cutting orientation of the sample piece with respect to the sample.
US11921039B2
A method and a control system of a food treating process made of a plurality of sub-processes is disclosed. The system comprises a plurality of product sensors including at least a spectrograph sensor and a thermograph sensor, plant sensors, control devices, a main hardware and software architecture apt, and a database structure to provide timely and automatic regulation controls, preferably exploiting synergies between various optimised parallel processes.
US11921037B2
Methods and apparatuses for gas detection are disclosed, including providing a device comprising: a light source configured to emit light; an array of vertical photonic crystal waveguides (VPCWs), wherein the VPCWs of the array of VPCWs are configured to slow and guide the light; and a detector array, wherein the detectors of the detector array are configured to measure the intensity of the light passing through each of the VPCWs of the array of VPCWs; wherein the VPCWs of the array of VPCWs slow and guide light having a wavelength within the absorption bands of the one or more gas species to be detected; exposing the apparatus to a gaseous environment such that gas from the environment flows through the array of VPCWs; and reading values from the detectors of the detector array to identify the presence of the one or more gas species. Other embodiments are described and claimed.
US11921031B2
A gas sensor comprises an enclosure configured to receive a gas. The enclosure comprises a sidewall extending, around a transverse axis, between a first wall and a second wall. The sensor also comprises a light source configured to emit a light wave that propagates in the enclosure and forms, from the light source, a first light cone. A measuring photodetector is configured to detect the light wave emitted by the light source and propagated through the enclosure. The first wall and the second wall each comprise at least one reflective surface, forming a portion of an ellipsoid of revolution. Each reflective surface is associated with a rank n, n being an integer greater than or equal to 1.
US11921023B2
Holographic Video Microscopy analysis of non-spherical particles is disclosed herein. Properties of the particles are determined by application of light scattering theory to holography data. Effective sphere theory is applied to provide information regarding the reflective index of a sphere that includes a target particle. Known particles may be co-dispersed with unknown particles in a medium and the holographic video microscopy is used to determine properties, such as porosity, of the unknown particles.
US11921021B2
A gas concentration device includes a first container, a second container, a pressure control device, and a path. The first container includes a first space surrounded by a first partition wall and stores a specimen, and a pressure inside the first space is reduced. The second container is airtightly connected to the first container by a first path and has a second space surrounded by a second partition wall and stores a gas flowing in from the first space. The pressure control device reduces a volume of the second space. A gas inside the second space is discharged through a second path.
US11921016B1
A soil probe assembly includes a frame member and a wheel rotatably coupled to the frame member. The wheel includes one or more soil probes that, as the wheel rotates against the earth, the weight of the soil probe assembly drives the soil probes into the earth. The wheel is configured to have at least two planar edges such that, as the wheel rolls onto one of the at least two planar edges, a slamming effect occurs due to the planar edge impacting against the ground, thus causing a soil sample to eject from a soil probe located across the wheel from the ground. The ejected soil sample is collected by a collection hamper. The assembly includes a funnel and a carousel such that the funnel is configured to receive and direct the ejected soil sample to the collection hamper, wherein the collection hamper is coupled to the carousel.
US11921014B2
A method includes receiving raw data and generating a manufacturing data packet (MDP) that includes at least a portion of the raw data. Generating the MDP includes associating metadata with the raw data and associating a timestamp with the raw data. The timestamp is synchronized to a common reference time. A data model associated with the MDP is obtained. The data model includes one or more predefined data types and one or more predefined data fields. A first data type from the one or more predefined data types is determined based at least in part on characteristics of the raw data. An algorithm is determined based at least in part on the first data type. The MDP is processed according to the algorithm to produce an output. The first data type is associated with the raw data. The output is associated with a data field of the first data type.
US11921013B2
A one-dimensional (1D) and two-dimensional (2D) scan scheme for a tracking continuously scanning laser Doppler vibrometer (CSLDV) system to scan the whole surface of a rotating structure excited by a random force. A tracking CSLDV system tracks a rotating structure and sweep its laser spot on its surface. The measured response of the structure using the scan scheme of the tracking CSLDV system is considered as the response of the whole surface of the structure subject to random excitation. The measured response can be processed by operational modal analysis (OMA) methods (e.g., an improved lifting method, an improved demodulation method, an improved 2D demodulation method). Damped natural frequencies of the rotating structure are estimated from the fast Fourier transform of the measured response. Undamped full-field mode shapes are estimated by multiplying the measured response using sinusoids whose frequencies are estimated damped natural frequencies.
US11921012B2
A measurement method includes: a high-pass filter processing step of performing high-pass filter processing on target data including a drift noise to generate drift noise reduction data in which the drift noise is reduced, a correction data estimation step of estimating, based on the drift noise reduction data, correction data corresponding to a difference between the drift noise reduction data and data obtained by removing the drift noise from the target data, and a measurement data generation step of generating measurement data by adding the drift noise reduction data and the correction data.
US11921007B2
A ground attachment system (1) for a tire characteristics detection unit (15) comprises an attachment plate (2) comprising a plurality of recesses (3) distributed over the surface of the attachment plate, a plurality of frustoconical clamping rings (4), and a plurality of cylindrical guide tunnels (5) arranged in the detection unit (15), the clamping rings (4) and the guide tunnels (5) each comprising a complementary conical portion (6, 7) converging towards the attachment plate (2) when the ring (4) is in the clamping position in a tunnel (5).
US11921002B2
A power transmission device includes: a first pulley; a second pulley having a diameter equal to or larger than a diameter of the first pulley; a belt wound around the first pulley and the second pulley; and a detection unit configured to detect a displacement of the belt in a direction intersecting the surface of the belt. The detection unit is configured to detect the displacement of the belt at a predetermined measuring point. The distance from the border between a portion where the belt and the first pulley are in contact with each other and a portion where the belt and the first pulley are not in contact with each other, to the measuring point is equal to or smaller than the diameter of the first pulley.
US11921001B2
A method and system for inspecting deviation in dynamic characteristics of a feeding system are provided, and the method includes: exciting the feeding system and detecting vibrations of a subcomponent of a component to be inspected of the feeding system to generate a monitoring excitation signal in a monitoring mode; calculating, by a modal analysis method, monitoring eigenvalues and monitoring eigenvectors of the monitoring excitation signal; determining, by a modal verification method, similarity between the monitoring eigenvalues and standard eigenvalues of a digital twin model and similarity between the monitoring eigenvectors and standard eigenvectors of the digital twin model; determining that the dynamic characteristics of the subcomponent are deviated, when the monitoring eigenvalues and monitoring eigenvectors are not similar to the standard eigenvalues and standard eigenvectors. Therefore, the subcomponent whose dynamic characteristics are deviated can be sensed remotely and precisely.
US11921000B2
There is provided optical power loss measurement method and system for that aims to provide a more productive way to perform optical power loss measurements involving test units typically at different locations. Visual fiber finder light can be used to assist the user at the other end of the optical fiber link under test in identifying where to connect the power meter unit. A visual fiber finder light and test light are combined on a same output port of a light source unit at one end of the optical fiber link under test wherein visual fiber finder light is interleaved with test light in a cyclic sequence so that both are not active at the same time. The optical power meter unit determines a time slot when to measure test light in accordance with the given cyclic sequence.
US11920989B2
An electronic device includes a module that delivers a positive temperature coefficient output voltage at an output terminal. A thermistor includes a first MOS transistor operating in weak inversion mode and having a negative temperature coefficient drain-source resistance and whose source is coupled to the output terminal. A current source coupled to the output terminal operates to impose the drain-source current of the first transistor.
US11920980B2
In some implementations, a device may receive spectroscopic data associated with a dynamic process. The device may generate a principal component analysis (PCA) model based on a first block of spectra from the spectroscopic data. The device may project a second block of spectra from the spectroscopic data to the PCA model generated based on the first block of spectra. The device may determine a value of a metric associated with the second block based on projecting the second block of spectra to the PCA model. The device may determine whether the dynamic process has reached an end point based on the value of the metric associated with the second block.
US11920976B2
A system for coupling photometers to an incubation ring for use in in vitro diagnostics comprises one or more light sources, and an incubation ring assembly, and two photometers. An incubation ring assembly comprises an internal trough and an external trough. Each trough comprises (a) an internal wall comprising an internal aperture and (b) an external wall comprising an external aperture. A first photometer comprises: a first optics housing directing light from the light sources through the external aperture of the internal trough, and a first detector positioned to receive the light through the internal aperture of the internal trough. A second photometer comprises a second optics housing directing the light from the light sources through the internal aperture of the external trough, and a second detector positioned to receive the light through the external aperture of the external trough.
US11920974B2
A vibration distribution measurement system includes a frequency sweep light source that outputs frequency sweep light, an optical splitter that splits the frequency sweep light into probe light and local light, an optical mixer that mixes backscattered light from the sensing fiber as signal light with the local light, the backscattered light being obtained by causing the probe light to be incident on the sensing fiber, and an analysis unit that analyzes a beat signal obtained from output light of the optical mixer. The analysis unit estimates a distance offset from a measurement result obtained by measuring a distribution waveform of the signal light by measuring the beat signal at a measurement time sufficiently shorter than a cycle of the vibration of the sensing fiber, and measures a distribution of a vibration at any position by compensating for the distance offset.
US11920972B2
The invention relates to a method for state monitoring of a coil that is part of a device for determining at least one process variable of a medium in a containment. The method includes supplying the coil with an electrical excitation signal and receiving an electrical, received signal from the coil, ascertaining a first frequency for the excitation signal, in the case of which a first phase shift between the excitation signal and received signal is less than a predeterminable limit value, and ascertaining a state indicator for the coil based on the first frequency. Further disclosed is a device embodied for performing a method of the invention.
US11920968B2
An apparatus and a method for ascertaining and billing for a volume of air generated by an air-conveying device. The air quantity ascertaining and billing apparatus has an air-conveying device generating an air volume flow through an air passage. A measuring device measures air-related parameters of the particular air volume flow. An analysis unit analyzes the measured parameters, in order to determine the total air volume that was conveyed by the air conveying device through the air passage over a period. A transfer device transfers the value determined for the air volume by the analysis unit to a validation device. The validation device links the air volume flow or the determined air volume to an economic value, in order to obtain a billing value for the generated air volume.
US11920962B2
A slight movement of the ground is detected. A cable, which includes an optical fiber, is provided to have friction with the ground in such a way that the optical fiber is expanded and contracted in accordance with the movement of the ground. An optical output unit outputs a monitoring light to the optical fiber. A partial reflection unit is provided on a path of the optical fiber in the cable and partially reflects the monitoring light. An optical reception unit receives a reflection light reflected by the partial reflection unit. A calculation unit measures the length of the optical fiber to the partial reflection unit based on a round-trip propagation time of the reflection light that has been received and monitors its changes over time.
US11920940B2
A system and method for adjusting an electric vehicle charging speed that include determining that an electric vehicle arrives at a charging station and determining a plurality of pricing schemes that are respectively associated with a plurality of charging speed tiers that pertain to respective charging speeds to charge the electric vehicle by the charging station. The system and method also include presenting a pricing scheme user interface that enables an operator of the electric vehicle to select a desired state of charge to charge a battery of the electric vehicle. The system and method further include actuating charging by the charging station at an operator preferred charging speed tier that is respectively associated with a particular charging speed tier of the plurality of charging speed tiers based on a selection of the particular charging speed tier by the operator through the pricing scheme user interface.
US11920939B2
It is intended to allow an appropriate route search to be performed even with a geographical NW in which accessibility information includes an uninvestigated link. A route appropriateness value calculation unit 160 calculates, for each of a plurality of routes each connecting a departure point and a destination extracted by a route extraction unit 120 and including links connecting individual spots including the departure point and the destination, a route appropriateness value of the route. The route appropriateness value of the route is calculated on the basis of a cost of the route calculated by a cost calculation unit 140 on the basis of a cost representing a degree of passage difficulty which is determined for each of the links with respect to a transportation means on the basis of accessibility information of the investigated link as well as a degree of passage uncertainty representing a possibility that the route cannot be passed through by the transportation mean which is calculated by a passage uncertainty degree calculation unit 150 on the basis of a length of the uninvestigated link included in the route. A route selection unit 180 selects, from among the plurality of routes, the route on the basis of the route appropriateness value of the route.
US11920938B2
Methods and systems for autonomous vehicle recharging or refueling are disclosed. Autonomous electric vehicles may be automatically recharged by routing the vehicles to available charging stations when not in operation, according to methods described herein. A charge level of the battery of an autonomous electric vehicle may be monitored until it reaches a recharging threshold, at which point an on-board computer may generate a predicted use profile for the vehicle. Based upon the predicted use profile, a time and location for the vehicle to recharge may be determined. In some embodiments, the vehicle may be controlled to automatically travel to a charging station, recharge the battery, and return to its starting location in order to recharge when not in use.
US11920923B2
The present disclosure discloses a water heater, and a scale detection system and method. The scale detection system comprises: a first temperature detector configured to acquire a first temperature of a heat exchange zone of a water heating device; a second temperature detector configured to acquire a second temperature indicating a water temperature in the water heating device; and a controller in communication with the first temperature detector and the second temperature detector, and configured to acquire a temperature difference between the first temperature and the second temperature based on the first temperature acquired by the first temperature detector and the second temperature acquired by the second temperature detector, and determine that a scale generation amount in the water heating device reaches a preset threshold when at least one of the following judgment conditions is met: the first temperature is not less than a preset temperature threshold; and the temperature difference is not less than a preset temperature difference threshold. The present disclosure can ensure that a user can be reliably and timely reminded to clean the scale under different working conditions.
US11920920B2
Described herein is a projector and illumination module configured for scene illumination and pattern projection. The projector and illumination module includes at least one array of a plurality of individual emitters and at least one optical system. Each of the individual emitters is configured for generating at least one illumination light beam. The at least one optical system includes at least one array of a plurality of transfer devices. The at least one array of the plurality of transfer devices includes at least one transfer device for each of the individual emitters. The at least one array of the plurality of transfer devices includes at least two groups of transfer devices. The transfer devices of one of the groups are configured for generating at least one illumination pattern. The transfer devices of the other group are configured for generating diverging light beams.
US11920919B2
An apparatus includes a display screen that includes OLED pixels disposed at a particular pitch in a first plane. A light projector includes light emitting elements disposed in a second plane parallel to the first plane. The light emitting elements are disposed at the same pitch as the OLED pixels or at an integer multiple of the pitch of the plurality of OLED pixels. The light emitting elements are operable to produce light at a wavelength for transmission through the display screen, and the first and second planes are separated from one another by a distance D such that d2=2*(λ)*(D)/(N), where d is the pitch of the OLED pixels, λ is the wavelength, and N is a positive integer.
US11920913B2
A conversion parameter calculation method includes: obtaining, from an image capturing device, image data obtained by the image capturing device capturing an image of an object having attached thereto a marker with which specific coordinates are detectable; obtaining displacement direction information indicating a direction of a displacement of the object, the direction crossing an image capturing surface of the image capturing device; detecting specific coordinates, based on the marker included in the image data; estimating a position of the image capturing device, based on a result of the detection; calculating distance data indicating a distance from the image capturing device to the object, based on the position of the image capturing device; and calculating, using the distance data and the displacement direction information, a conversion parameter for converting a pixel displacement amount of the object into an actual displacement amount.
US11920909B2
A Powder Dispersal Target Impact Indication System (PDS) includes a body configured to contain a powdered substance for dispersing into air external to the body on impact of a target by a firearm projectile. A mounting structure is used to mount the body to the target. A securing cap is configured to retain the powdered substance within the body. A dispersal aperture is configured to disperse the powdered substance.
US11920902B2
A method of delivering charge to a remote target includes pressurizing a reservoir of metallic conductor initially at a temperature below its melting point. The method includes flowing the metallic conductor through an orifice to form a continuous thread with axial velocity, so that a user might direct the axial velocity of the thread to intercept the remote target. The method further includes applying a potential differential along the thread so that electrical current flows between the reservoir and the remote target.
US11920897B2
This invention provides a universal tactical light fixing mechanism which includes a base, a pull rod and a lock block; the pull rod passes through the base and one end thereof is disposed inside the base; the base is provided with a mounting slot for mounting a tactical light; the pull rod is provided with a handle at one end thereof which is distant from the base for controlling the pull rod to move up and down; the handle is rotatably connected with the pull rod; the base is connected with a first screw; the lock block cooperates with the first screw to provide clamping force; the lock block is provided with a gear; the pull rod has a side surface which is provided with slots that match protruding teeth on the gear; the gear is disposed inside the base and engaged with the side surface of the pull rod.
US11920888B2
Systems, methods, and apparatuses are described for accelerating projectiles at high velocity. A barrel may include one or more heaters configured to heat a bore of the barrel prior to launch of a projectile. The barrel bore may be formed in a tungsten sleeve and may be heated to high temperatures. Heat from the barrel bore may be transferred to expanding propellant behind a projectile as it travels through the barrel bore.
US11920886B2
A weapon is capable of firing cased telescoped (CT) ammunition rounds. The weapon includes a barrel, a chamber member that defines a chamber configured to hold a CT round for firing from the weapon, a non-rotating carrier body, and linkage. The linkage is constructed and arranged to move the chamber member (i) from a firing position in which the chamber member is aligned with the barrel for firing the CT round to an ejection/loading position in which the chamber member is not aligned with the barrel for ejecting a spent CT round and receiving a next CT round in response to the non-rotating carrier body moving away from the barrel, and (ii) from the ejection/loading position to the firing position in response to the non-rotating carrier body moving toward the barrel.
US11920881B1
The present disclosure provides systems and techniques for identifying gun events. A gun event may include a nominal event, such as the discharging of a projectile or the ejecting of a cartridge shell, or an anomalous event, such as a misfire or a failure to feed. An apparatus may include a sensor that measures motion of a gun along multiple axes. The apparatus may identify a gun event based on the measured motion of the gun satisfying a motion condition. The motion condition may include an acceleration threshold value, and the measured motion of the gun may satisfy the motion condition based on a measured acceleration value exceeding the threshold acceleration value. The apparatus may transmit an electrical signal based on the measured motion of the gun satisfying the motion condition. The electrical signal may reset a charging circuit, increment a shot count, or decrement a round count.
US11920873B2
The invention relates to a wound heat exchanger having a core tube extending along a longitudinal axis in an axial direction and having a tube bundle, which has a plurality of tubes for conducting a first fluid, wherein the tubes are wound about the core tube in a plurality of windings, the tubes being arranged in a radial direction perpendicular to the axial direction in a plurality of tube layers, adjacent windings of at least one tube layer having different axial distances in the axial direction and/or tube layers adjacent in the radial direction having different radial distances from each other in a cross-sectional plane perpendicular to the longitudinal axis. The invention further relates to a method for producing a wound heat exchanger and to a method for transferring heat between a first fluid and a second fluid by means of the heat exchanger.
US11920871B2
A thermal battery system may be provided comprising: a vessel comprising a phase change material and a gas; a heat exchanger configured to transfer heat to and/or from the phase change material; a temperature sensor configured to detect an indication of a temperature of the gas; a pressure sensor configured to detect an indication of a pressure of the gas; and a processor configured to determine a state of charge of the thermal battery system from the indication of the pressure and the indication of the temperature of the gas.
US11920865B2
Devices and methods for cleaning and/or drying endoscopic instruments, such as endoscopes, are provided. A drying device for use with an endoscopic instrument comprises an elongate member configured for advancement through an internal lumen within the endoscopic instrument and a drying member removably coupled to a portion of the elongate member. The drying element comprises a variable pressure region shaped and configured to increase the hydrodynamic fluid friction force and fluid pressure force applied to the wall of the internal lumen of the endoscope to more effectively remove all of the moisture and fluid from the internal surfaces of an endoscopic instrument.
US11920856B2
A refrigerator includes a storage chamber having an opening; a drawer type door to open or close the opening; a display positioned at the drawer type door; a first connector provided at a sidewall of the storage chamber; a second connector provided at the drawer type door and being electrically connected to the display; a first frame coupled to an inner wall of the storage chamber, the first frame to cover the first connector; a second frame coupled to the drawer type door, the second frame to support a storage box; and a wire electrically connected between the first connector and the second connector. The first frame has a first accommodating part to accommodate one portion of the wire and the second frame has a second accommodating part to accommodate another portion of the wire.
US11920846B2
A refrigerator of the present invention may comprise: a first tray assembly forming a part of an ice making cell; and a second tray assembly forming the other part of the ice making cell. The first tray assembly includes a first tray, and the second tray assembly includes a second tray. The second tray includes a first portion forming at least a portion of the ice making cell, and a second portion extending from a predetermined point of the first portion. The second portion includes a first extension part extending from a first point of the first portion and a second extension part extending from a second point of the first portion, wherein the length of the second extension part in the horizontal direction is formed longer than the length of the first extension part.
US11920844B2
An air distribution mechanism and a corresponding cryogenic refrigerator are provided. The air distribution mechanism includes an air distribution valve (6) and a rotary valve (7), the air distribution valve (6) includes an air distribution valve main body (6a) and an air distribution valve seat (6b), an air distribution plane (6a3) that is on the air distribution valve main body (6a) and faces away from the air distribution valve seat (6b) protrudes relative to the air distribution valve seat (6b), the air distribution plane (6a3) is tightly attached to a switching plane (73) on the rotary valve (7), and the switching plane (73) protrudes from the rotary valve (7); the air distribution valve (6) is fixedly mounted in a mounting chamber of a cover (2), and the rotary valve (7) is rotatable around a principal rotation axis O of the rotary valve relative to the air distribution valve (6) to switch connection states of an air distribution side flow path and a switching side flow path. The cryogenic refrigerator includes the air distribution mechanism. The air distribution mechanism can avoid performing surface treatment on the rotary valve 7 to reduce costs, and only the rotary valve 7 is a moving component, to ensure the device stability.
US11920843B2
A chiller includes an evaporator, a compressor including a prime mover, a first pressure sensor that detects a first pressure in the evaporator, a second pressure sensor that detects a second pressure in a condenser, and a controller. The controller determines a predicted energy level of the compressor based on the first pressure and the second pressure, the predicted energy level associated with liquid droplet flow into the compressor, compares the predicted energy level to an operating energy level, and modifies the at least one of the input power and the input current to the prime mover based on the comparison satisfying a modification condition.
US11920842B2
A method for controlling a vapour compression system (1) including a compressor unit (2) including at least two compressors (3, 12), a heat rejecting heat exchanger (4), a receiver (6), an expansion device (7) and an evaporator (8) arranged in a refrigerant path is disclosed. At least one of the compressors is a main compressor (3) being fluidly connected to an outlet of the evaporator (8) and at least one of the compressors is a receiver compressor (12) being fluidly connected to a gaseous outlet (10) of the receiver (6). A flow of vapour entering the receiver (6), such as a mass flow of vapour entering the receiver (6) is estimated and compared to a first threshold value. In the case that the estimated flow is above the first threshold value, a pressure prevailing inside the receiver (6) is controlled by operating the receiver compressor (12).
US11920841B2
An air-conditioning apparatus includes a main circuit in which a compressor, a flow switching device, an indoor heat exchanger, a pressure reducing device, and a plurality of parallel heat exchangers connected in parallel with each other are connected by pipes, a bypass pipe, a flow control device provided to the bypass pipe and configured to adjust a flow rate of refrigerant flowing through the bypass pipe, an evaporating pressure sensor configured to measure an evaporating pressure of the refrigerant, and a controller. The air-conditioning apparatus is configured to operate in a normal heating operation mode and a heating-defrosting operation mode. When an operation associated with the normal heating operation mode is switched to an operation associated with the heating-defrosting operation mode, the controller adjusts an opening degree of the flow control device using the evaporating pressure in the parallel heat exchanger and a driving frequency of the compressor.
US11920831B2
A heating unit for a heating, ventilation and/or air conditioning (HVAC) system may have a first airflow path through the heating unit, a second airflow path through the heating unit, and a heater assembly having a first heating coil positioned within the first airflow path, a second heating coil positioned within the second airflow path, and a coil divider separating the first heating coil and the second heating coil.
US11920822B2
An air handling unit has an interior wall configured to selectively retain a removable component of the air handling unit. An air handling unit has an interior wall configured as a drain pan. An air handling unit has an outer skin joined to the interior wall, an insulator disposed between the interior wall and the outer skin, and the interior wall has a mounting channel configured to selectively retain a removable component of the air handling unit.
US11920812B2
An air conditioning system for controlling air conditioning in a room in accordance with an air conditioning operation instruction received from a user includes: a ventilation device ventilating the room; an air agitation device agitating air in the room; an air conditioner controlling the air conditioning of the room and operations of the ventilation device and the air agitation device; and a detection device detecting presence of the user in the room. The air conditioner controls the operations of the ventilation device and the air agitation device before the user enters the room based on an indoor temperature inside the room, an outdoor temperature outside the room, an operation mode of air conditioning control performed by the air conditioner included in the air conditioning operation instruction, an operating status of the ventilation device, and a detection result provided by the detection device.
US11920805B2
The present invention provides a heating, ventilation, and air-conditioning (HVAC) system using an A2L refrigerant and a method of installing the HVAC system in a building. The HVAC system includes an indoor unit having a heat exchanger that uses an A2L refrigerant, a blower, an outdoor unit, an A2L control board, and one or more A2L sensors configured to detect an amount of A2L refrigerant. In one or more embodiments, the indoor unit is electrically coupled to the blower, the A2L control board, and the outdoor unit. Also, in one or more embodiments, the A2L control board is also electrically coupled to the blower and the one or more A2L sensors.
US11920801B2
A digital fluid heating system may include a solar collection system configured for focusing sunlight on a focal axis, an elongated flow element arranged and configured for transporting fluid along the solar collection system at the focal axis, and a flow-control assembly comprising a digitally controlled valve configured to control the flow of the fluid in the elongated flow element such that pathogens present in the fluid are substantially inactivated before the fluid exits the fluid heating system and at a maximized flow rate under the given energy providing conditions. The system may also include one or more digital controls and communication systems for remote and/or automatic control.
US11920800B1
An electric space heater having foldable panels is disclosed. A foldable panel may comprise a plural plate-like members and a flexible non-conductive material. The plural plate-like members including (i) a first plate-like member, a second plate-like member, a third plate-like member. The first plate-like member may have a heating element having a first radiation emitting surface and a second interior surface, and (b) a board adhesively bonded to said second interior surface; the second plate-like member may have (a) a heating element having a first radiation emitting surface and a second interior surface, and (b) a board adhesively bonded to said second interior surface; the third plate-like member may have (a) a heating element having a first radiation emitting surface and a second interior surface, and (b) a board adhesively bonded to said second interior surface.
US11920788B2
This invention comprises a lighter which is used for meeting the people's needs by obtaining a flame and/or spark through a finger move, characterized in that it comprises at least one groove at its side part and/or front part wherein said devices are positioned for ensuring standing and stable use of electronic books, tablet computers, mobile phones and such devices at a comfortable viewing angle.
US11920786B2
A regenerative burner including: a combustion chamber; a heat exchange chamber; and a communication passage therebetween, the combustion chamber includes a tip of a fuel nozzle and a flame ejection port, and is configured such that fuel introduced from the fuel nozzle into the combustion chamber can be burned in the combustion chamber using combustion air introduced into the combustion chamber through the communication passage to eject flame from the flame ejection port; the fuel nozzle is configured such that fuel burned in the regenerative burner is introduced into the combustion chamber; and the heat exchange chamber comprises a heat accumulator interposed between the communication passage and an air port, and is configured such that combustion air can pass through the heat accumulator and then be introduced into the combustion chamber such that an exhaust gas passes through the heat accumulator and is discharged from the air port.
US11920776B2
The luminaires of the present disclosure provide a slim profile and simple construction for use in a variety of lighting applications. A circuit board can have a plurality of light sources thereon, and a lens can at least partially encapsulate the circuit board to protect and electrically insulate the circuit board. When used, for example, in a lighted shelf application, power can be provided to the luminaire through shelf brackets along the side of the shelf panel.
US11920770B2
Example embodiments described herein involve a system for testing a light-emitting module. The light-emitting module may include a mounting platform configured to hold a light-emitting module for a camera. The mounting platform may also be configured to rotate. The system may further include a housing holding a plurality of photodiodes arranged in an array over at least a 90 degree arc of a hemisphere. The system may also include a controller configured to control the photodiodes and the rotation of the mounting platform.
US11920766B2
Various embodiments are directed to an adjustable light fixture and method of installing the same. Various embodiments of the adjustable light fixture comprise a light head comprising a light source, a lens, and a frame; a socket base configured to be secured relative to a socket of a light assembly; and an extender located between the light head and the socket base and configured to move between an extended configuration and a compressed configuration. In various embodiments, the adjustable light fixture is installed by engaging the socket base with a corresponding socket of a light assembly and adjusting the extender toward the compressed configuration.
US11920762B2
A control method for an illuminating device, which is mounted on an aircraft having an image acquisition apparatus, includes obtaining attitude data of an image acquisition apparatus and rotating the illumination device, according to the attitude data of the image acquisition apparatus, to match an illumination area of the illumination device with a photographing area of the image acquisition apparatus.
US11920758B2
Disclosed herein are systems and methods for melting cold weather related obstructions (snow, ice, frost, etc.) off of vehicle lamps by heating the lens of the housing, thus restoring the normal operating abilities (e.g., brake light illumination, running light illumination, turn signal illumination). This can allow for an efficient signaling process (e.g., to the following vehicle), thus raising the general level of safety on the roads.
US11920737B2
Device for storing and for supplying fluid fuel, comprising a reservoir of liquefied fuel gas in equilibrium with a gas phase, in particular hydrogen, a circuit for filling the reservoir, at least one circuit for tapping fluid from the reservoir, and at least one circuit for regulating the pressure in the reservoir, the filling circuit, tapping circuit and pressure-regulating circuit comprising a set of valves arranged in a housing separate from the reservoir, the housing being removably connected to the reservoir via a demountable mechanical coupling system, the tapping circuit, the pressure-regulating circuit and the filling circuit comprising a set of demountable fluidic connectors situated at the junction between the reservoir and the housing and configured to allow the separation between portions of circuits situated in the reservoir and in the housing during the demounting of the housing with respect to the reservoir.
US11920735B2
Method for thermal insulation of an evacuable container comprising an inner container, an outer container and a cavity disposed between the inner container and the outer container, wherein said method comprises a) using a vacuum pump to reduce a pressure in the cavity and after achieving a first value of the pressure interrupting the connection to the vacuum pump, b) subsequently making a connection from a reservoir container of the thermally insulating particulate material to a filling opening provided in the region of the cavity, c) setting the evacuable container into motion, wherein the thermally insulating particulate material flows into the cavity according to a) and the pressure in the cavity increases due to the air introduced with the thermally insulating particulate material, d) terminating the filling at a second value of the pressure by interrupting the connection from the cavity to the reservoir container, e) repeating step a), wherein the output of the vacuum pump with which the cavity is deaerated is controlled such that the profile over time of the mass flow exiting from the cavity of air introduced with the thermally insulating particulate material is at a maximum, f) subsequently repeating steps b)-e) up to the desired degree of filling and g) as the final step sealing the evacuated cavity.
US11920732B2
A quality control method for the preparation of dry compressed gas cylinder including passivating and/or preparing the compressed gas cylinder with the technique to be validated, filling the passivated/prepared compressed gas cylinder with gaseous carbon dioxide to a normal working pressure, wherein the gaseous carbon dioxide has a known δ18O isotope ratio, maintaining the pressurized gas cylinder at ambient temperature for a first predetermined period of time, and gradually emptying the pressurized gas cylinder, while simultaneously measuring the δ18O isotopic ratio, wherein a predetermined variation in the measured isotopic ratio of δ18O indicates a properly prepared cylinder.
US11920727B2
A deployable light for an electronic device, such as a cellular telephone, that attaches to the electronic device with a magnetic connector. The deployable light is adapted to deploy from a stowed position wherein the light may shine in a first direction, to a deployed position wherein the light may shine opposite the first direction. The deployable light may include a magnetic connection portion for attachment to a cellular telephone. The deployable light may provide light when the telephone is using either its forward facing camera or it rearward facing camera.
US11920723B2
A vacuum adiabatic body includes: a first plate member; a second plate member; a sealing part sealing the first plate member and the second plate member to provide a third space in a vacuum state; a supporting unit; a heat resistance unit for decreasing a heat transfer amount between the first plate member and the second plate member; and an exhaust port through which a gas in the third space is exhausted. The heat resistance unit includes a conductive resistance sheet capable of resisting heat conduction flowing along a wall for the third space, and a side frame fastened to the conductive resistance sheet to define at least one portion of the wall for the third space. Accordingly, a vacuum adiabatic body may be capable of resisting heat conduction.
US11920716B2
A fluid connector, comprising a first connector body, a second connector body and a latching body which is configured to connect the first connector body to the second connector body, the latching body having a first non-destructively non-releasable latching device and a second non-destructively releasable latching device, the latching body being configured to be pushed both onto a radially outer side of the first connector body and onto a radially outer side of the second connector body.
US11920715B2
A coupling assembly includes a female quick connector and a male member, wherein the male member has a latching element, a sealing section and a tip, wherein the sealing section is disposed between the latching element and the tip. The quick connector includes a retainer having at least one retaining element. The male member is in a latching position if the latching element is latched onto the at least one retaining element. The quick connector includes a verifier which is axially movable along a verification path, wherein the verification path comprises at least one locking position and at least one releasing position. The verifier in the locking position limits a movement of a section of the retainer in radial direction, so that the retainer is not actuatable in the locking position but actuatable in the releasing position of the verifier.
US11920702B2
A connecting element for a pipe arrangement, comprising a base body with at least one through channel, a receiving bore for receiving a pipe end of a pipe, wherein the receiving bore corresponds with the through channel, wherein the receiving bore has a larger cross section than the through channel, wherein a transition step is introduced into the base body between the through channel and the receiving bore, and an arrangement and a method for manufacturing an arrangement.
US11920700B2
Rotary valves and methods of using, manufacturing, and storing the same are provided herein. The rotary valve includes a rotor and a stator, biased toward one another to form a fluid tight seal. In some implementations, the rotor comprises an integrated flow channel containing a porous solid support. Frequently, the interface between rotor and stator is made fluid-tight using a gasket. Some implementations of the rotary valve include a displaceable spacer to prevent the gasket from sealing against at least one of the rotor and stator prior to operation, wherein when the spacer is displaced, the gasket seals the rotor and stator together in a fluid-tight manner.
US11920699B2
Disclosed is ball valve with automatic safety exhaust function, which is suitable for working environments in high pressure applications, such as up to 600 psi of water, oil, and gas. The ball valve includes a valve body, cap, ball with a vent hole, stem, a built-in vent needle valve, and seals. When the valve is in the closed position, the built-in needle valve is in the open state. The downstream gas enters the bottom of the valve cavity from the exhaust hole on the ball and exits the valve body through the needle valve hole. When the ball valve is in the open position, the built-in needle valve is in the closed state. The built-in needle valve design ensures that under high-pressure use (open state), the gas will not leak out of the valve body.
US11920696B2
A first opening and closing mechanism, which includes a first cam groove and a first cam roller and which causes a valve assembly to reciprocate between an intermediate position and a first closed position, and a second opening and closing mechanism, which includes a second cam groove and a second cam roller and which causes the valve assembly to reciprocate between the intermediate position and a second closed position, are provided so as to be operable separately, the first and second opening and closing mechanisms being disposed adjacent to each other in a thickness direction D of a gate valve.
US11920687B2
A valve assembly includes an actuator adapted to drive movement of a valve member. The valve assembly also includes a bonnet coupled to the actuator, a valve body coupled to the bonnet, and a fluid end coupled to the valve body. The valve assembly further includes a quick connection system adapted to couple the fluid end to the valve body. The quick connection system includes a plurality of valve body lugs separated by a plurality of spaces, the plurality of valve body lugs extending radially outward from an axis. The quick connection system also includes a plurality of fluid end lugs configured to interact with the plurality of valve body lugs, the plurality of valve body lugs being arranged to axially align with the plurality of fluid end lugs to block axial movement of the fluid end with respect to the valve body.
US11920680B2
A vehicle includes a chain tensioner that serves as an oil damper using oil supplied from an oil pump. The vehicle includes a controller that controls a traveling mode of the vehicle in a BEV mode or a non-BEV mode. When shifting the traveling mode from the BEV mode to the non-BEV mode, the controller executes a high-pressure process for controlling the oil pump such that a supply pressure of oil supplied to the chain tensioner becomes higher when a duration of the BEV mode is greater than or equal to a specified time than when the BEV mode duration is less than the specified time.
US11920677B2
A system including a gearbox and a hydraulic machine connected by a working fluid circuit. The gearbox including a gearbox housing having first and second gearbox fluid passages integrated into the gearbox housing. The hydraulic machine including a case having first and second hydraulic machine fluid passages, the first and second hydraulic machine fluid passages being integrated into the case. A set of rotating elements enclosed within the case. The first gearbox fluid passage and the first hydraulic machine fluid passage align to form a feed passage to conduct fluid at a first pressure from a first source to the set of rotating elements. The second gearbox fluid passage and the second hydraulic machine fluid passage align to form a charge passage to conduct fluid at a second pressure from a second source to the set of rotating elements. The first pressure being less than the second pressure.
US11920674B2
In this shift device, in a case in which an external force has acted on a lever when an operating mechanism is causing the lever to pivot, a clutch mechanism permits rotation of a first detent plate with respect to a second detent plate, such that pivoting of the lever is permitted. Note that a restraining mechanism urges the lever toward a shift position. This enables to the restraining mechanism to urge the lever separately to the clutch mechanism, thereby enabling the degrees of freedom for setting a biasing load on the lever by the restraining mechanism to be increased.
US11920658B2
A rack steering system and a motor vehicle having such a rack steering system. The inventive rack steering system comprises a steering gear housing, a toothed rack, which extends through the steering gear housing, an electric motor, which is coupled to the toothed rack on a thread side of the steering gear housing via a ball screw to provide an axial force to the toothed rack, and two track rod links arranged at axial ends of the toothed rack. The steering gear housing is designed in one piece such that a drive insert opening is formed on the thread side of the steering gear housing for arrangement of the electric motor and a direct stop face for a track rod link or a support face for the arrangement and axial support of a separate stop element for a track rod link is also formed on this thread side.
US11920649B2
An example robot includes: a motor disposed at a joint configured to control motion of a member of the robot; a transmission including an input member coupled to and configured to rotate with the motor, an intermediate member, and an output member, where the intermediate member is fixed such that as the input member rotates, the output member rotates therewith at a different speed; a pad frictionally coupled to a side surface of the output member of the transmission and coupled to the member of the robot; and a spring configured to apply an axial preload on the pad, wherein the axial preload defines a torque limit that, when exceeded by a torque load on the member of the robot, the output member of the transmission slips relative to the pad.
US11920648B2
A slip clutch device for an electric driving machine includes a rotation axis, an input side rotatable about the rotation axis, an output side rotatable about the rotation axis, and a slip clutch connecting the input side to the output side in a torque-limiting manner. The slip clutch includes an electrical insulation element for preventing an electrical disruptive discharge line between the input side and the output side, a friction disc, and a friction plate, pressed against the friction disc in a contact region in a frictionally engaged torque-transmitting manner. The friction disc or the friction plate is formed from an electrically insulating material in an insulation region extending radially over the contact region, and the insulation region is a bearing structure for radially transmitting torque.
US11920647B2
In one aspect of the present disclosure, a disc brake rotor assembly is provided that includes a disc brake rotor and a wheel hub. One of the disc brake rotor and the wheel hub includes a plurality of pairs of partial keyways and the other of the disc brake rotor and the wheel hub includes intermediate partial keyways configured to fit intermediate the pairs of partial keyways to form keyways. The disc brake rotor assembly further includes a plurality of fasteners configured to be received in the keyways to secure the disc brake rotor and the wheel hub together.
US11920646B2
A method for operating a friction-locking shift element of a transmission of a motor vehicle includes actuating the friction-locking shift element for engagement according to a pressure versus torque characteristic curve. The pressure versus torque characteristic curve has a first characteristic point (a touch point) and a second characteristic point (a contact point), defines a first characteristic curve range between the touch point and the contact point having a first functional dependence, and defines a second characteristic curve range at or after the contact point having a second functional dependence. Once the touch point is reached, the friction-locking shift element begins to transmit torque mainly due to drag torques. Whereas, once the contact point is reached, the friction-locking shift element begins to transmit torque mainly due to friction between shift-element halves of the friction-locking shift element.
US11920640B2
A slave device is provided for a clutch system of a motor vehicle, in particular a clutch slave cylinder, in the form of a concentric slave cylinder. The slave device includes a housing element having, in its interior, a pressure chamber and an annular gap arranged on the outside of the housing element wherein the annular gap is in fluid communication with the pressure chamber. A clutch system for a vehicle includes the slave device, clutch apparatus for connecting an input side to an output side, a transmission housing on the output side, and seals of the slave device lying against the transmission housing in the radial direction for sealing the annular gap.
US11920628B2
An equipment mounting system for mounting equipment to a support structure is described. An equipment mounting system including: (i) a mounting plate having defined therein a plate aperture of a particular shape; (ii) a bolt having a shaft portion including a threaded portion and a non-threaded portion that is of a complementary shape that complements the particular shape of the plate aperture; and (iii) a washer having defined therein a scored aperture that includes multiple radially extending scorings. In an assembled configuration of the mounting plate, the bolt and the washer, the plate aperture of the particular shape aligns with the scoring aperture such that both of the plate aperture and the scoring aperture receive the non-threaded portion of the complementary shape, and the particular shape of the mounting plate engages with the complementary shape of the bolt to prevent rotational displacement of the bolt around the mounting plate.
US11920627B2
Embodiments are directed to a carabiner that includes a carabiner body forming an opening having a width, the carabiner body including a gate rest notch, and a gate rest. The carabiner further includes a pivotable gate coupled to the carabiner body at a pivotable point and adapted to contact the gate rest notch when in a closed position. The carabiner body is sized to accommodate an object with an aperture and a thickness, and the width is approximately less than 100% greater than the thickness.
US11920623B2
A fastener assembly of the present disclosure includes a grommet including a head having a through-hole formed therein and at least one leg extending downward from the head; and a pin configured with a head and a shaft inserted into the grommet. The grommet and the pin are integrally formed by a connection tip.
US11920606B2
Fuel pump for an aircraft engine, comprising an inducer and a centrifugal impeller fixed together and having an axis of rotation, an annular space spacing axially the inducer and the impeller, and two contact portions between the inducer and the impeller disposed radially outside the annular space, a first plenum chamber and a second plenum chamber, in which the inducer and the impeller are spaced axially from each other, each being disposed between the two contact portions, the plenum chambers being symmetrical to each other with respect to the axis of rotation and in fluid communication with the annular space, the centrifugal impeller comprising a plurality of axial balancing holes distributed about the axis of rotation and opening out into the annular space at one end, and into a downstream space of the impeller at the other end.
US11920594B2
A screw compressor slide valve with gas pulsation attenuation function includes valve walls and internal through holes. A screw compressor includes the screw compressor slide valve. A part of exhausted gas of the screw compressor is directly discharged from an exhaust port to an exhaust chamber to form a main exhaust flow channel; another part of the exhausted gas is discharged from the exhaust port into the exhaust chamber after being delayed by the internal through holes, which forms a branched exhaust flow channel. Since the branched exhaust flow channel is longer than the main exhaust flow channel, when the gas pulsation in the branched exhaust flow channel lags behind that in the main exhaust flow channel by 180-degree in phase, two gas pulsations in the two flow channels are offset due to opposite gas pulsation phases, which attenuates the gas pulsation, thereby suppressing induced vibration and noise.
US11920591B2
An electric oil pump includes a motor including a motor shaft, a pump assembly including a vane pump driven by the motor to suction and discharge oil, and an inverter to drive the motor. The motor includes a rotor, a stator on a side outward from the rotor in a radial direction, and a motor housing containing the rotor and the stator. The motor housing includes a suction port through which the vane pump suctions oil from outside, and a discharge port through which the vane pump discharges oil to outside. The motor housing includes flat surface portions in a portion of an outer periphery thereof. The suction port and the discharge port are located in a first surface of side surfaces which are the flat surface portions of the motor housing and are parallel or substantially parallel to the axial direction.
US11920587B2
A fluid routing plug for use with a fluid end section. The fluid end section being one of a plurality of fluid end sections making up a fluid end side of a high pressure pump. The fluid routing plug is installed within a horizontal bore formed in a fluid end section and is configured to route fluid between an intake and discharge bore. The fluid routing plug comprises a plurality of first and second fluid passages. The first and second passages do not intersect and are offset from one another. The first fluid passages are configured to direct fluid delivered to the horizontal bore from intake bores towards a reciprocating plunger. The second fluid passages are configured to direct fluid pressurized by the plunger towards a discharge bore.
US11920579B2
A pumping system pumps material or fluid downhole, for example, to perform a stimulation operation. The pumping system can include a hydraulic pump coupled to an intensifier. The intensifier may have a piston which allows for a small footprint as compared to an intensifier with a plunger. The hydraulic cylinder of the intensifier may be protected from the corrosive, erosive and/or abrasive effects of the material or fluid to be pumped by one or more seals. Using the intensifier that includes a piston may provide for a greater reliability of the overall pumping system, as fewer strokes are required, and a compact pumping system, as the stroke length of the intensifier with a piston is less than the stroke length required for a plunger.
US11920575B2
A pump for inflating tires with air is provided. The pump includes a body having a base and a top portion and a cutout configured to receive a tire of a bicycle. The base is configured to be anchored to the ground. The pump includes a handle assembly including a piston rod and a handle bar. The pump includes a tube positioned in the body and secured to at least one plate in the body. The tube slidably receives the piston rod and is connected to an air line. The pump includes a hose connected to the air line and extending from the body. The hose has a head configured to engage a nozzle of the tire. When the piston rod is moved downward within the tube, air is displaced from the tube and through the air line to the hose such that the head dispenses air.
US11920573B2
A pressure exchanger (1) including a housing (2), a drive shaft (3) and a cylinder drum (4) rotatably arranged in the housing (2) is described, the cylinder drum (4) including two front faces and at least one cylinder (5) between the front faces, wherein the housing (2) includes a port flange (7, 8) at each end of the cylinder drum (4) and at least at one end of the cylinder drum (4) a pressure shoe (18) is arranged between the cylinder drum (4) and the port flange of this end. Such a pressure exchanger should be operated in a cost-effective manner. To this end an adjustable stop arrangement (19) is arranged between the pressure shoe (18) and the cylinder drum (4).
US11920562B2
A method of estimating a temperature of a component of a wind turbine is provided, comprising, during a calibration period, receiving measurements of the temperature of the component and of one or more corresponding operational parameter; and calculating, using the measurements coefficients of a model of the temperature of the component. The model relates temperature at a current time to a temperature a preceding time, Tn−1. The model is segregated into separate bins based on wind speed or power generated by the wind turbine. The method further comprises using the model to estimate a temperature of the wind turbine.
US11920557B2
A first aspect of the invention provides a wind turbine blade having a blade shell that defines a suction side, pressure side, leading edge, and a trailing edge of the blade. The blade further comprises a blade heating system comprising one or more heating elements configured to heat the blade in first and second heating areas, wherein the first heating area is closer to the leading edge than the second heating area is, and the heating system is configured to generate heat fluxes in the first and second heating areas such that the heat flux generated in the first heating area is lower than the heat flux generated in the second heating area.
US11920551B2
A unique point absorber type wave energy conversion device is disclosed that includes a Power Take Off (PTO) which uses a torsion spring to return a vertical shaft to its original position after being rotated by a rope or cord that pulls a reel via a guide system. This spring return allows the PTO and housing to stay stationary under the wave energy while a buoy at the surface provides an oscillating linear movement. The oscillating rotary motion caused by the interaction of the buoy and spring is converted into a one directional motion via a one-way clutch and is transmitted to generators using a gearbox that increases rotational speed.
US11920548B2
A system for preventing an engine included in a work machine from restarting, after the work machine is tipped over. A sensor included in the work machine is configured to detect a tipping incident. If a tipping incident is detected, the sensor sends out a signal configured to shut down the engine and a tilt signal configured to prevent the engine from restarting. The engine is only restarted if certain steps are undertaken by an operator and a reset switch is activated.
US11920539B1
An exhaust nozzle for a gas turbine engine. The exhaust nozzle comprises a nozzle body having an upstream end axially spaced from a downstream end with respect to an axial centerline of the nozzle body, and a plurality of chevrons circumferentially spaced apart and extending downstream from the downstream end. Each chevron includes an inner wall radially spaced from an outer wall, a root and a tip axially spaced from the root. At least one chevron of the plurality of chevrons includes a first segment extending axially downstream from the root, a second segment extending axially downstream from the first segment, and a third segment extending axially downstream from the second segment to the tip. The inner wall extends along the first segment, the second segment, and third the segment. The first segment is distinguishable from the second segment and the second segment is distinguishable from the third segment.
US11920535B2
A system includes a reciprocating piston engine configured to output torque to drive a load. The system includes an engine speed sensor operatively coupled with the engine and configured to output an engine speed signal. The system includes an electronic control system operatively coupled with the powertrain. The electronic control system is configured to determine an engine acceleration in response to the engine speed signal, and detect a misfire of the engine in response to the engine acceleration.
US11920534B2
A CPU is configured to executes a filter regeneration process, a firing process, and a stopping process. The CPU is configured to stop rotation of a crankshaft of an internal combustion engine mounted on a vehicle on the condition that the vehicle is decelerating after termination of the firing process in the stopping process.
US11920525B2
Fuel injectors for gas turbine engines include an inner housing having a center body installed within the inner housing, an intermediate housing arranged radially outward from the inner housing, and an outer housing arranged radially outward from the intermediate housing. The center body is a hollow body structure defining a center body airflow passage therethrough, a first fluid passage is partially defined between an outer surface of the inner housing and an inner surface of the intermediate housing, a second fluid passage is partially defined within the intermediate housing, and a third fluid passage comprises the center body airflow passage, an inner airflow passage defined between an exterior surface of the center body and an interior surface of the inner housing, and an outer airflow passage that is defined by the outer housing and radially outward from the intermediate housing.
US11920520B2
In a rotary electric machine housing, a first bearing and a second bearing are provided for supporting a rotating shaft. A lubricating oil is supplied to the first bearing and the second bearing. At least one of the first bearing or the second bearing is sandwiched between the compressed air supplied from one side of the rotating shaft in an axial direction thereof and the compressed air supplied from another side of the rotating shaft in the axial direction.
US11920514B1
A gas turbine engine including a fuel delivery system arranged to provide fuel; a combustor arranged to combust at least a proportion of the fuel; a primary fuel-oil heat exchanger arranged to have up to 100% of the fuel provided by the fuel delivery system flow therethrough; and a secondary fuel-oil heat exchanger arranged to have a proportion of the fuel from the primary fuel-oil heat exchanger flow therethrough. Fuel is arranged to flow from the primary fuel-oil heat exchanger to the secondary fuel-oil heat exchanger whereas oil is arranged to flow from the secondary fuel-oil heat exchanger to the primary fuel-oil heat exchanger. The method includes using at least one of the primary fuel-oil heat exchanger and the secondary fuel-oil heat exchanger to heat the fuel so as to adjust the fuel viscosity to a maximum of 0.58 mm2/s on entry to the combustor at cruise conditions.
US11920494B2
The present invention relates to a turbomachine rotary-fan blade (2), comprising a body (20) made of a composite material, a metal reinforcement part (3) comprising a metal upstream nose (31), characterised in that the metal upstream nose (31) comprises, at least on the metal part (27b) of the blade tip, a recess (4) of longitudinally tapering thickness (AX), delimiting on the metal part (27b) over a height (H) at least one metal projection (5) with prescribed wear, which has a longitudinally tapering thickness and which is configured to detach at least partially in the presence of tangential friction in the second thickness direction (EP) against the metal part (27b), the recess (4) and the metal projection (5) with prescribed wear extending the first metal fin (32) and/or the second metal fin (33) and/or the upstream edge (22) of the body (20) made of composite material.
US11920491B2
A gear assembly for use with a turbomachine comprises a sun gear, a plurality of planet gear layshafts that each support a first stage planet gear and a second stage planet gear, and a ring gear. The sun gear is configured to rotate about a longitudinal centerline of the gear assembly, and the plurality of planet gear layshafts comprise an interior passage that receives one or more lubrication supply lines.
US11920489B2
An exhaust turbocharger including a modular bearing designed for bearing a shaft and arranged between a compressor and a turbine is provided herein. The bearing has a bearing housing having a receptacle chamber, wherein a bearing assembly module can be or is installed in the receptacle chamber and can be non-destructively removed. The receptacle chamber is sized such that either a bearing assembly module having a rolling bearing or a bearing assembly module having a slide bearing can be installed. The receptacle chamber has an interface, designed to contact the bearing flange of a bearing assembly module inserted into the receptacle chamber. The interface is designed to connect an oil gallery passing through the bearing housing to one or more oil galleries passing through a bearing flange of the bearing assembly module.
US11920479B2
A method of operating a multi-engine system of a rotorcraft includes, during a cruise flight segment of the rotorcraft, controlling a first engine to provide sufficient power and/or rotor speed demands of the cruise flight segment; and controlling a second engine to by providing a fuel flow to the second engine that is between 70% and 99.5% less than a fuel flow provided to the first engine. A turboshaft engine for a multi-engine system configured to drive a common load is also described.
US11920477B2
A seal includes a ceramic matrix composite ply having woven ceramic-based fibers in a ceramic-based matrix. The ceramic matrix composite ply has at least one bend formed about a bend axis and defines at least one rounded portion. A sealed assembly and a method of making a seal are also disclosed.
US11920475B2
A motion conversion apparatus (100) comprises a rodrack assembly (110), which includes two guide members (140) and a first gear connection member (120) comprising opposing engaging arrangements (1201). The motion conversion apparatus (100) further comprises a gearshaft member (150) causing reciprocating linear motion of the rodrack assembly (110) along a reciprocation direction (D) by rotational motion of the gearshaft member (150). The gearshaft member (150) includes a second gear connection member (160) configured to engage with the first gear connection member (120), and a guiding surface arrangement (170) configured to contact a guide member (140) during rotational motion of the gearshaft member (150), wherein one gearshaft member (150) revolution causes a single period of reciprocating linear motion of the rodrack assembly (110). The guiding surface arrangement (170) contacts one of the two guide members (140) at an endpoint of the reciprocating linear motion of the rodrack assembly (110).
US11920473B2
A device for integrated control of acid wastewater plugging and discharging of an abandoned mine includes an airtight wall, a central controller, a CO2 gas source, an agent bucket, a siphon pipe I and a liquid storage bucket are arranged on the outer side of the airtight wall, and a plurality of monitoring sensors are arranged in the inner side of the airtight wall, and the monitoring sensors are electrically connected to the central controller; and a flood discharge valve is arranged at the bottom of the airtight wall. The device is miniaturized and operates for a long time with low power consumption, thereby achieving long-term unattended operation and maintenance.
US11920467B2
Systems and methods include a computer-implemented method for determining normalized apparent power. Drilling acoustic signals corresponding to a time domain and generated during drilling of a well. A fast Fourier transformation (FFT) is performed using the drilling acoustic signals to generate FFT data. Normalized FFT data is generated using normalization parameters and a drill string rotation rate record of a drill string used to drill the well. The drill string rotation rate is received during drilling. Normalized apparent power is determined from data points of a predetermined top percentage of the normalized FFT data within a lithological significant frequency range. The normalized apparent power is a measure of the power of the drilling acoustic signals and it is a function of the amplitude and frequency of the normalized FFT data. The lithological significant frequency range is a frequency range within which the drill sounds are more closely related with lithology.
US11920462B2
Disclosed are methods, systems, and computer-readable medium to perform operations including: generating, based on production data for a wellbore, (i) a water-oil-ratio with respect to time (WOR) dataset for the wellbore, (ii) a time-derivative dataset (WOR′) of the WOR dataset; generating a WOR log-log plot of the WOR dataset and a WOR′ log-log plot of the WOR′ dataset; identifying at least one trend in the WOR log-log plot and the WOR′ log-log plot; determining, based on the at least one identified trend, a first type of water breakthrough; generating, based on pressure data from a build-up pressure test in the wellbore, a log-log plot of time-derivative pressure data with respect to time (P′); determining, based on the P′ log-log plot, a second type of water breakthrough; correlating the first and second type of water breakthrough; and determining, based on the correlation, whether to perform a water treatment for the wellbore.
US11920459B2
A method for drilling a subterranean wellbore includes rotating a drill string in the subterranean wellbore to drill the wellbore. The drill string includes a rotary steerable tool or a steerable drill bit including at least first and second axially spaced pads configured to extend radially outward from a tool body and engage a wall of the wellbore. Radial displacements of each of the first and second axially spaced pads are measured while drilling. The measured radial displacements are processed to compute a rate of penetration of drilling.
US11920453B2
A method of dynamically allocating a total amount of produced water (PW) from a reservoir during enhanced oil recovery (EOR) via a low salinity or softened water EOR flood by receiving measurement data; receiving reservoir configuration information comprising: an EOR injection rate associated with one or more EOR injection zones, a disposal zone injection rate associated with one or more disposal injection zones, and a non-reinjection disposal rate associated with one or more non-reinjection disposal routes; determining a blending rate comprising at least a portion of the PW production rate and at least a portion of the low salinity or softened water injection rate to provide a blended injection fluid; blending at least a portion of the PW with at least a portion of the low salinity or softened water at the blending rate; and dynamically allocating the PW production rate among injection and/or non-reinjection routes.
US11920450B2
Methods, systems, and devices to enhance fracturing fluid delivery to subsurface formations to enhance hydrocarbon production from the subsurface formations may include providing a manifold coupling having a manifold coupling passage with a manifold coupling axis. The manifold coupling may include a first inlet passage positioned to provide fluid flow between a first fracturing fluid output and the manifold coupling passage, and a second inlet passage positioned opposite the first inlet passage to provide fluid flow between a second fracturing fluid output and the manifold coupling passage. The first inlet passage may have a first inlet passage cross-section at least partially defining a first inlet axis extending transverse relative to the manifold coupling axis. The second inlet passage may have a second inlet passage cross-section at least partially defining a second inlet axis extending transverse relative to the manifold coupling axis and not being co-linear with the first inlet axis.
US11920441B2
Systems and methods for using stratigraphic heat maps to steer a well being drilled. Data from one or more offset wells can be provided to a computer system and used with data from a well being drilled to generate one or more stratigraphic heat maps during the drilling of the subject well. The stratigraphic heat maps can be displayed and used to determine the location of the wellbore relative to one or more geological formations, including one or more target formations or within a target formation. Based on the use of the heat maps and the location of the wellbore relative to a target, the drill plan can be adjusted or updated and/or one or more drilling parameters or operations may be adjusted to drill the wellbore, such as to drill the wellbore to the target or to maximize the length of the wellbore within a target zone.
US11920436B2
A downhole tool can be used as a fill valve to circulate a fluid, such as a spacer fluid, through the tool. The tool can include a top and bottom flapper valve and an inner and outer sliding sleeve. The sliding sleeves can be shifted together to allow the top flapper valve to close. Continued shifting of the inner sleeve can cause the bottom flapper valve to close. A cementing operation can then be performed through the tool. Sealing elements can be located between the outside of the inner sleeve and inside of the outer sleeve. Sealing elements can also be located between the outside of the outer sleeve and the inside of a tool mandrel. The sealing elements can prevent debris from becoming lodged within the tool.
US11920435B2
A sub-surface safety valve having a positional flapper, a valve seat, and a remotely actionable opening prong. The opening prong comprising at least one of a debris wiper, filter, and at least one flow hole. The wiper, filter, and at least one flow hole function according to either position or movement of the flapper and opening prong and prevent debris buildup around the valve seat. The wiper is an extendible material in communication with the valve seat and a surface of the opening prong and it extends radially in response to closing the valve. The extension of the wiper in response to closing the flapper cause the wiper to scrape the surface of the valve seat. The filter can comprise a screen integrated with or attached to the opening prong. The flow holes can be in the form of angled flow holes or elongated slots.
US11920434B2
A method comprising operating a first valve arrangement and a second valve arrangement from a locked first configuration, in which the first port is closed and the second port is closed, to a locked second configuration, in which the first port is open and the second port is closed, wherein the first valve arrangement comprises one or more locking devices configured to lock a first valve member of the first valve arrangement in place relative to the tubular body. The method comprising operating the first valve arrangement and the second valve arrangement from the locked second configuration to a third configuration, in which the first port is closed and the second port is open.
US11920432B2
A toe valve for use in a wellbore includes: a tubular mandrel; a housing extending along a periphery of the mandrel; couplings for assembly as part of a casing or liner string; and a valve piston. The valve piston is: disposed in an annulus formed between the housing and the mandrel, movable between an open position and a closed position, and disposed between a valve port of the housing and a valve port of the mandrel in the closed position. The toe valve further includes: an atmospheric chamber for facilitating movement of the valve piston to the open position; a vent port formed through the housing and in fluid communication with the atmospheric chamber; and a flow control device disposed in the vent port and operable to prevent fluid flow from the wellbore into the atmospheric chamber and allow fluid flow from the atmospheric chamber into the wellbore.
US11920423B2
A tubing hanger assembly includes a tubing hanger body, a downward facing load shoulder axially displaceable relative to the body, an annular load member rotatably supported on the body, and a torque member operatively engaged between the load member. The load shoulder and load member are arranged such that rotation of the load member relative to the body results in axial displacement of the load shoulder relative to the body. In use, the torque member rotates the load member to thereby displace the load shoulder axially relative to the body.
US11920412B2
A device and method used for inspecting and measuring coiled tubing, production tubing or drill pipe as it enters the well. Defects such as internal and external wall loss, cracking and deformation can be detected and quantified. The axial motion of the tubing can be measured allowing for depth measurements that are more accurate and reliable than what can be obtained using an encoder wheel system.
US11920408B2
A cutting element includes a base and a cutting face at opposite axial ends, a side surface extending between the base and the cutting face, an edge formed between the cutting face and the side surface, an edge chamfer having a uniform size around the entire edge, and a geometric shape formed on the cutting face and defined by a concave boundary with respect to a longitudinal axis of the cutting element. The concave boundary includes multiple rounded vertices, each rounded vertex located proximate to the edge chamfer and forming a cutting tip and multiple geometric shape sides connecting the rounded vertices, wherein the geometric shape sides are concave with respect to the longitudinal axis.
US11920400B2
The invention relates to a sensor device (10) for a vehicle (100), comprising a control unit (11) for actuating a movable part (101), in particular a tailgate, of the vehicle (100), and a sensor unit (12) for monitoring at least one first activation region (A1), wherein the control unit (11) is designed to actuate the movable part (101) of the vehicle (100) when at least one activation action (H1, H2, H3, B1, B2) of a user in the first activation region (A1) has been sensed by the sensor unit (12). The sensor unit (12) is designed to sense the at least one activation action (H1, H2, H3, B1, B2) of the user by means of electromagnetic waves in the radio frequency range.
US11920383B2
A restraint system includes an elongated member extending between a first end portion and a second end portion. A first handcuff is mounted to the elongated member at the first end portion of the elongated member, and a second handcuff is mounted to the elongated member at the second end portion of the elongated member. A first handle is positioned adjacent the first handcuff, and a second handle is positioned adjacent the second handcuff.
US11920381B2
A shielded locking system for securely closing a lid on an enclosure, such as a grade level utility vault, including an L-bolt connected to a spring-biased slide member positioned on the underside of the lid that rotates in a slotted housing that securely retains the L-bolt under the lid, the slide member engaging an abutment on the inside of the enclosure when the lid is forced down over an opening in the enclosure by downward force on the lid which progressively causes the latch to retract against the spring-bias from contact with the abutment and then snaps the latch into a spring-biased locking position under the abutment, and a non-conductive cover positioned over and connected to the locking system to shield the L-bolt from electrical conductivity from within the enclosure.
US11920376B2
The present disclosure relates to a bi-directional overrunning clutch, electronic door locks having bi-directional overrunning clutches, and methods of using the same. In certain embodiments, the electronic door lock includes a first locking mechanism for driving an inner wheel through a first torque to rotate a rotatable shaft to operate a locking device on a door by a user from outside, a second locking mechanism for driving inner wheel through the first torque to operate the locking device from an inside, a third locking mechanism for driving an outer wheel rotatable coaxially around the rotatable shaft through a second torque to operate the locking device electronically, and the bi-directional overrunning clutch. When outer wheel rotates at second torque, inner wheel and rotatable shaft rotate along with outer wheel, and when inner wheel rotates at first torque, outer wheel does not rotate along with inner wheel and rotatable shaft.
US11920370B2
The invention relates to a perforating device for thermoplastic plates, which relates to the technical field of a plate processing device. The device comprises an electromagnetic chuck, one side of the electromagnetic chuck is connected with the motion part, the other side of the electromagnetic chuck is connected with a mounting plate and a spike. When the electromagnetic chuck is powered on, the spike is attracted below the mounting plate by the electromagnetic force. A clamping part is arranged below the mounting plate, the thermoplastic plate is fixed by the clamping part, and a heating system is also provided to heat the thermoplastic plate. As the electromagnetic chuck is powered on or off, the spike can be attracted in or separated from the mounting plate, respectively. Therefore, the perforating device can make a new plate be pierced during the cooling and curing process of the perforated plate.
US11920365B2
A modular partition track system includes a modular base portion configured to be positioned on a ground surface. A first track subsystem is positioned on at least a portion of a first surface of the modular base portion. The first track subsystem includes one or more slidable partition coupling assemblies configured to slide along the first track subsystem.
US11920357B2
A stringer for a decking support frame, the stringer including a structural body having a front side, a back side, a top side, and a bottom side. The structural body also includes a plurality of weld free mounting tabs integral with the structural body extending from the top side and away from the bottom side. A plurality of apertures extend evenly spaced along a longitudinal length of the structural body and each aperture extends completely through the front side to the back side.
US11920351B2
A vent is disclosed that is particularly suited to use in ventilating attic spaces beneath a hip roof. The vent is configured to be installed along a hip of the roof overlying and covering a ventilation slot formed through the roof deck along the hip. The vent includes an elongated laterally flexible top panel from which baffle arrays depend. The baffle arrays are formed of a plurality of depending arcuately curved vanes that arc away from the vent. The vanes are aerodynamically shaped to redirect wind-blown rain and snow away from the vent and are configured to block the migration of rain and snow through the vent. A pair of spongy conformable filler strips is attached beneath the edge portions of the vent. The filler strips conform to the shapes of underlying shingles when the vent is installed to fill any gaps that otherwise might be formed between the vent and the shingles. A weather filter drapes over some of the baffle arrays to allow attic air to pass but prevent ingress of blown snowflakes and raindrops.
US11920350B2
A drainage device is provided. The drainage device includes a drainage head having at least one head portion having an internal collection space and provided with at least one through recovery passage, and an attachment sleeve at least partially deformable. The attachment sleeve can be secured to the drainage head and capable of being inserted inside the flow pipe. The drainage device further includes a compression washer attached on the attachment sleeve and a central screw. The central screw can be movable in relation to the drainage head and threadably engaged with the compression washer to obtain, under the effect of a rotation of the central screw relative to the drainage head, an axial movement of the compression washer on the side of the drainage head and an outward radial deformation of the attachment sleeve.
US11920341B2
A rail assembly is provided, suitable for embedding in concrete, including a profile rail having a rail body, wherein the rail body has a first lateral wall, a second lateral wall, a first rail lip protruding from the first lateral wall, and a second rail lip protruding from the second lateral wall. The rail assembly has a reinforcing element with a force-absorbing body, wherein the force-absorbing body is positioned in front of the first lateral wall of the profile rail for contacting the first lateral wall of the profile rail with the force-absorbing body. A construction body having a concrete element, in which a rail assembly of this type is embedded is also provided, as is a method.
US11920339B2
A hanger for connecting a structural component to a wall that can have sheathing mounted thereon either before or after the hanger is connected to the wall. The hanger includes a channel-shaped portion configured to receive the structural component. An extension portion extends from the channel-shaped portion and is configured to extend through the sheathing to engage the wall at a first location. A connection portion is configured for attachment to the wall at a second location spaced from the first location.
US11920330B2
A method of manufacturing a tap body and a tap is disclosed together with a tap body and a tap made by the process. The present techniques may relate to domestic water taps or faucet. According to the method, first and second hollow body parts are made. The first body part comprises a first pair of apertures. The second body part comprises opposed open ends. The second body part also comprises at least one aperture between the opposed open ends. The method further comprises the steps of inserting the first body part into the at least one aperture on the second body part to make a tap outer body, and aligning the first pair of apertures of the first body part with the opposed open ends to define a channel through the tap outer body.
US11920329B2
A bath faucet system includes a housing, a diverter assembly, and an internal waterway. The housing forms an outer shell of the bath faucet system and includes a water inlet, a water outlet, and a cavity extending between the water inlet and the water outlet. The internal waterway is disposed within the cavity between the water inlet and the water outlet. The internal waterway includes a water jacket and a hose. The water jacket is coupled to the water inlet and configured to contain water flowing into the housing via the water inlet. The water jacket includes a hose connector along an outside surface of the water jacket. The hose includes a first end coupled to the hose connector, a second end coupled to the water outlet, and a central portion connecting the first end to the second end and configured to prevent water from contacting the housing.
US11920327B2
A water control system for the cold and hot water plumbing installations, for consumption or heating and gray water in a home, premises or building increases water and/or energy efficiency of the installation by means of a method of operation which reduces the water consumption or energy used in its consumption and treatment. The method includes detecting and controlling water leaks, avoiding consumption of cold water which is produced while waiting for hot water to come out, reducing the energy required for consuming hot water, reducing consumption of water when it is used for the toilet together with a soap, foam or similar, measuring and controlling the proliferation of Legionella bacteria and other microorganisms, cleaning pipes and in general monitoring the control variables of a plumbing installation and its visualization and interaction by a user or a smart and autonomous IT system.
US11920323B2
A counterweight assembly for a work machine includes a structure, support studs, a first side wall, and a second side wall. The structure is coupled to a frame of the work machine and defines through holes, a first side end, and a second side end. The support studs are coupled to the frame and correspondingly received into the through holes to support the structure against the frame. The first side wall extends from the first side end and defines a first eyelet. The second side wall extends from the second side end and defines a second eyelet. A work machine guard rail is received between the first side wall and second side wall. One or more of the first eyelet and the second eyelet receive a lifting assembly for lifting the work machine, and the support studs transfer a lifting force from the counterweight assembly to the frame.
US11920314B2
A fish pass system includes a helical blade having an outside diameter and an inside diameter extending between a first side of the helical blade and a second side of the helical blade. The inside diameter controls a flow of water flowing in a direction from the first side to the second side, and the inside diameter defines an open center of the fish pass system. Fish traveling in an opposite direction to the direction of the flow of the water pass through the fish pass system by riding in a space between helical blades as the helical blades are rotating, and fish traveling in the direction of the flow of the water pass through the open center of the fish pass system by swimming or moving over the inside diameter of the helical blades.
US11920311B2
A method of operating an ultra-high pressure liquid jet system includes positioning, relative to a rail, a translatable frame having a liquid jet processing head fluidly connected to an ultra-high pressure liquid pump. The method also includes providing, to the liquid jet processing head, via the ultra-high pressure liquid pump, a pressurized fluid forming a liquid jet that contacts the rail such that the pressurized fluid is at least 20,000 PSI during a rail cutting operation or a re-profiling operation. Steps of the method include providing an abrasive feed system coupled to the liquid jet processing head to provide an abrasive to the liquid jet and translating the liquid jet processing head relative to the rail, thereby performing a processing operation on a linear length of the rail along a direction of translation of the rail.
US11920307B2
Provided are tissue webs, and products produced therefrom, that are generally durable, flexible and have improved cross-machine direction (CD) properties, such as CD tensile energy absorption (CD TEA), CD stretch and CD modulus. The inventive tissue products generally comprise multiple tissue plies, such as two or more plies, that have been prepared by through-air drying and more preferably by through-air drying without creping. Moreover, the plies may be produced in a through-air drying process that utilizes a transfer fabric positioned between the forming fabric and the through-air drying fabric where the transfer fabric imparts the nascent web with a high degree of CD strain.
US11920304B2
The present invention describes a method for preparing graphene by mixing graphite and carbon nanofibrils. The prepared graphene can be used to form nanopaper. The present invention also provides a method of preparing nanopaper by suspending cellulose nanofibrils and graphene, followed by vacuum filtering of the suspension.
US11920302B2
The woven papermaking fabrics have a machine direction (MD) axis and a cross-machine direction (CD) axis, a machine contacting surface and a web contacting surface. The web contacting surface comprises a plurality of MD and CD oriented protuberances. Generally, the MD oriented protuberances are formed from warp filaments and may be continuous across one dimension of the papermaking fabric. The CD oriented protuberances are formed from shute filaments and are discrete. The fabrics may be woven such that the CD oriented protuberances traverse at least one MD oriented protuberance and in other instances two or more MD oriented protuberances. In addition to MD and CD oriented protuberances, the web contacting surface comprises valleys disposed between adjacent MD oriented protuberances. The valleys are generally permeable to air and water and aid in the formation and structuring of webs manufactured using the fabrics.
US11920299B2
A formation detection system comprising: (a) one or more sensors and (b) one or more lights that illuminate a location of interest so that the one or more sensors can monitor the location of interest; wherein one of the one or more sensors are located substantially planar with a wire of a paper machine and proximate to a slice opening so that the one of the one or more sensors is adjacent to a cut through so that the one of the one or more sensors is capable of measuring stock above the wire and removed water below the wire, and wherein the one of the one or more sensors is capable of measuring a distance between an impingement location of a stock jet and the wire from a forming board.
US11920295B2
Provided is an elastomer reinforcement cord in which the problem of stress concentration at an interface between an elastomer and a metal cord is solved and the durability is thereby improved. The elastomer reinforcement cord includes metal filaments (1a) and (1b), and a polymer material (3) having a melting point or softening point of 80° C. to 160° C. The elastomer reinforcement cord has a core (11) and at least one sheath layer (12). In a region surrounded by a line connecting the centers of the metal filaments constituting the outermost sheath layer at a cross-section in a direction orthogonal to an axial direction after vulcanization, when a region occupied by other than the metal filaments is defined as a gap region, the polymer material is contained in this gap region, and a filling rate, which is a ratio of the area of the polymer material, is higher than 120%, taking the area of the gap region as 100%.
US11920279B2
The present disclosure relates to a laundry washing machine, comprising a rotatable drum (3), a suspension arrangement (29, 31) carrying the drum in relation to a base structure (7) located under the washing machine on which the washing machine rests, and a load sensing device (9), configured to sense the load of the drum (3). A first structural element (11) extends in a first plane and is connected to either of the drum and the suspension arrangement, and a second structural element (13) extends in a second plane, parallel with the first plane, and is connected to the other of the drum and the suspension arrangement. The load sensing device is attached to the second structural element on a surface thereof facing away from the first structural element and is connected to the first structural element. This allows for a compact load sensing arrangement.
US11920272B2
A laundry appliance having: a treatment chamber; and a humidity measuring arrangement for measuring the humidity of at least one item to be treated. The humidity measuring arrangement has a sensing capacitor and a capacitance sensing unit for measuring a capacitance of the sensing capacitor and obtaining an indication of the humidity of the item to be treated according to the measured capacitance. The sensing capacitor has first and second electrical conductors and a dielectric. A volume of the chamber forms part of the dielectric. The appliance has an extension member configured to be positioned within the chamber for extending the first electrical conductor within the laundry treatment chamber. The extension member has an extension conductor and a coupling conductor, and the extension conductor can be electrically coupled to the first electrical conductor through a capacitive coupling via the coupling electrical conductor.
US11920270B2
A method for manufacturing fabric with flat screen and digital printed patterns includes: singeing, pretreatment, flat screen scraping sizing, drying, pattern printing, humidification, steaming treatment, washing, and non-ironing and soft setting. The pretreatment is a biological enzyme pretreatment process including: cloth feeding at 75° C., dipping, scouring and bleaching in a working fluid, heating to 90° C. for treatment of 30 minutes, draining, hot water washing and cold water washing. A shortened process flow can be realized, and the positioned sizing that uses a flat screen to scrape a sizing agent to a pattern position to be digital spray-printed on instead of traditional full-width sizing for sizing and printing, which greatly reduces the amount of sizing agent used, lowers production cost and reduces waste water pollution, and solves problem that the fabric is mottled caused by the application of sizing agent in areas without printed pattern due to full-width sizing.
US11920264B2
The present invention relates to a yarn clearer for a workstation of a textile machine with a cutting device for clearing out defects from a yarn as well as a cutting device for a yarn clearer which can be arranged at a workstation of a textile machine, with a housing body having a housing basic body, a housing cover which covers the housing basic body at least in sections and together with the housing basic body delimits a housing interior and a first housing opening and a cutting device with a cutting medium carrier having a cutting knife, a cutting medium drive arranged in the housing interior for adjusting the cutting medium carrier between a cutting position remote from the housing and a rest position close to the housing and a drive element connecting the cutting medium drive and the cutting medium carrier and adjustably arranged in the first housing opening. In order to provide a yarn clearer with a cutting device as well as a cutting device which ensure reliable separation of the yarn when required, there is provision for the housing body to have a bearing section for adjustably receiving the cutting medium carrier and a second housing opening adjacent to the bearing section with an opening edge extending perpendicularly to the adjustment direction of the cutting medium carrier and abutting the cutting medium carrier.
US11920259B2
The disclosure discloses a washable flame retardant viscose fabric. The viscose fabric includes a flame retardant viscose fiber; and a method of preparing the viscose fiber includes the following steps: impregnation, squeezing, ageing, yellowing, addition before spinning, spinning, bundling, drafting, cutting off, first washing, desulfurization, second washing, pickling, third washing, application of oil bath, drying, and packaging. Before spinning, an aqueous dispersion of flame retardant, an aqueous dispersion of hyperbranched nanocellulose and a dispersant are uniformly added to a spinning glue using a pre-spinning injection system. During the production of the flame retardant viscose used, the aqueous dispersion of flame retardant, the aqueous dispersion of hyperbranched nanocellulose and the dispersant are introduced into the spinning glue by the pre-spinning injection system before spinning, so that the flame retardant has a high residual rate in the subsequent coagulation bath.
US11920258B2
Antibody libraries comprising a plurality of heavy chain variable domains and/or a plurality of light chain variable domains, which comprise complementary determining regions (CDRs) found in naturally-occurring human antibodies, and methods of making such antibody libraries. The antibody libraries are free of members that comprise one or more liabilities affecting one or more features of such members. Further, the antibody libraries comprise members having heavy chain and/or light chain CDRs not found in the same naturally-occurring human antibody.
US11920254B2
The present disclosure relates to an electroplating system including a first contact detection sensor and a second contact detection sensor disposed at a surface of a cone of the electroplating system. The first contact detection sensor detects a first resistance at a first contact between a substrate to be plated by the electroplating system and a first contact pin, the second contact detection sensor detects a second resistance at a second contact between the substrate and a second contact pin. A controller receives the first resistance and the second resistance, and determines the first contact and the second contact are not properly formed when a difference between the first resistance and the second resistance is not within a first predetermined resistance range, or the first resistance or the second resistance is not within a second predetermined resistance range.
US11920250B2
Provided herein is an electrodialysis metathesis system that has at least one stack or quad of compartments arranged so each compartment is in fluid communication with its adjacent compartment via alternating cation- and anion-exchange membranes. The compartments in a stack are a feed compartment, a substitution salt solution compartment, a first concentrated compartment and a second concentrated compartment. Also provided are processes and methods for separating or recovering a metal, for example, a rare earth element, or a salt or a combination thereof from a salt-containing water. Simultaneous metathesis reactions and electrodialysis across the stack recovers one or more metal or salts from the salt-containing water which desalinates the salt-containing water.
US11920248B2
The present disclosure provides systems and methods for producing carbon products via electrochemical reduction from fluid streams containing a carbon-containing material, such as, for example, carbon dioxide. Electrochemical reduction systems and methods of the present disclosure may comprise micro- or nanostructured membranes for separation and catalytic processes. The electrochemical reduction systems and methods may utilize renewable energy sources to generate a carbon product comprising one or more carbon atoms (C1+ product), such as, for example, fuel. This may be performed at substantially low (or nearly zero) net or negative carbon emissions.
US11920246B2
A method for producing one or more hydroxide solids includes providing a catholyte comprising an electrolyte solution; contacting the catholyte with an electroactive mesh cathode to electrolytically generate hydroxide ions, thereby precipitating the one or more hydroxide solid(s); and removing the one or more hydroxide solids from the surface of the mesh where they may deposit.
US11920237B2
The present disclosure provides a multifunction chamber having a multifunctional shutter disk. The shutter disk includes a lamp device, a DC/RF power device, and a gas line on one surface of the shutter disk. With this configuration, simplifying the chamber type is possible as the various specific, dedicated chambers such as a degas chamber, a pre-clean chamber, a CVD/PVD chamber are not required. By using the multifunctional shutter disk, the degassing function and the pre-cleaning function are provided within a single chamber. Accordingly, a separate degas chamber and a pre-clean chamber are no longer required and the overall transfer time between chambers is reduced or eliminated.
US11920229B2
Provided are new high strength 6xxx aluminum alloys and methods of making aluminum sheets thereof. These aluminum sheets may be used to fabricate components which may replace steel in a variety of applications including the transportation industry. In some examples, the disclosed high strength 6xxx alloys can replace high strength steels with aluminum. In one example, steels having a yield strength below 340 MPa may be replaced with the disclosed 6xxx aluminum alloys without the need for major design modifications.
US11920227B2
An object of the present invention is to provide a Pd alloy, a Pd alloy material, and a probe pin for electric and electronic devices in which specific resistance, hardness, and processability are balanced at a higher level than before, and methods for manufacturing the same. In order to achieve this object, the Pd alloy for electric and electronic devices according to the present invention having a composition comprising 50.1 mass % or more and 55.5 mass % or less of Pd, 6.3 mass % or more and 16.1 mass % or less of Ag, 30.0 mass % or more and 38.0 mass % or less of Cu, and 0.5 mass % or more and 2.0 mass % or less of In is adopted.
US11920220B2
The present invention relates to a 3D-printed cobalt-based alloy product comprising carbon, tungsten and chromium with very good mechanical and thermal properties as well as a method of preparing the 3D-printed product and a powder alloy. The alloy has a high carbon content leading to high carbide content but small and evenly distributed carbides. A method facilitating 3D printing of high carbide content alloys such as the present alloy is also disclosed.
US11920214B2
Plants and methods recover spent refractory material and comprise at least one receiving area for said refractory material, at least one material sieving area, at least one magnetic separation area, and at least one sorting area. Said receiving area communicates with a first sieving area divides said refractory material in at least two fractions based on sizes of said refractory material. A second sieving area divides a fine fraction into at least two sub-fractions.
US11920207B2
A cold rolled heat treated steel sheet having a composition with the following elements, expressed in percentage by weight 0.1%≤Carbon≤0.5%, 1%≤Manganese≤3.4%, 0.5%≤Silicon≤2.5%, 0.03%≤Aluminum≤1.5%, 0%≤Sulfur≤0.003%, 0.002%≤Phosphorus≤0.02%, 0%≤Nitrogen≤0.01% and can contain one or more of the following optional elements 0.05%≤Chromium≤1%, 0.001%≤Molybdenum≤0.5%, 0.001%≤Niobium≤0.1%, 0.001%≤Titanium≤0.1%, 0.01%≤Copper≤2%, 0.01%≤Nickel≤3%, 0.0001%≤Calcium≤0.005%, 0%≤Vanadium≤0.1%, 0%≤Boron≤0.003%, 0%≤Cerium≤0.1%, 0%≤Magnesium≤0.010%, 0%≤Zirconium≤0.010%, the remainder composition being composed of iron and unavoidable impurities caused by processing, the microstructure of the steel sheet having in area fraction, 10 to 30% Residual Austenite, 50 to 85% Bainite, 1 to 20% Quenched Martensite, and less than 30% Tempered Martensite.
US11920199B2
This document provides methods and materials related to genetic variations of developmental disorders. For example, this document provides methods for using such genetic variations to assess susceptibility of developing Autism Spectrum Disorder.
US11920196B2
A method comprising obtaining a substantially cell-free sample of blood plasma or blood serum from a subject with osteoarthritis; and detecting a presence of or measuring a level of novel_miRNA_1 (gucuggcucaggguuggg) (SEQ ID NO: 1), novel_miRNA_2 (ucccuguucgggcgccacu) (SEQ ID NO: 2), novel_miRNA_3 (uguuuagcauccuguagccugc) (SEQ ID NO: 3), and novel_miRNA_4 (uaguggguuaucagaacu) (SEQ ID NO: 4). Also provided are methods where additional miRNAs are detected including novel miRNA 5 (SEQ ID NO: 5), novel miRNA 6 (SEQ ID NO: 6), novel miRNA 7 (SEQ ID NO: 7), novel miRNA 8 (SEQ ID NO: 8), novel miRNA 9 (SEQ ID NO: 9), novel miRNA 10 (SEQ ID NO: 10), novel miRNA 11 (SEQ ID NO: 11), novel miRNA 12 (SEQ ID NO: 12), novel miRNA 13 (SEQ ID NO: 13), hsa-miR-335-3p, hsa-miR-199a-5p, hsa-miR-671-3p, hsa-miR-1260b, hsa-miR-191-3p, hsa-miR-335-5p and/or hsa-miR-543.
US11920189B2
Disclosed herein are devices and methods for amplifying double stranded DNA molecules. Methods for amplifying apoptotic cell-free DNA molecules can include performing end-repair and dA tailing of the cfDNA molecules, attachment of single-stranded hairpin adaptors to both ends of the end-repaired cfDNA molecules to produce adaptor-tagged, single-stranded, covalently closed DNA molecules, and amplification of the adaptor-tagged, single-stranded, covalently closed DNA molecules by a combination of rolling circle amplification and multiple displacement amplification using a PrimPol enzyme, a DNA polymerase with strand displacement activity and free nucleotides.
US11920186B2
Methods for imaging are described, including, but not limited to a method comprising: (1) contacting a sample being tested for the presence of one or more targets with one or more target-specific binding partners, wherein each target-specific binding partner is linked to a docking strand, and wherein target-specific binding partners of different specificity are linked to different docking strands, (2) optionally removing unbound target-specific binding partners, (3) contacting the sample with antigen-bound imager strands and antigen-specific binding partners linked (directly or indirectly) to optical labels, wherein the antigen-bound imager strands have complementarity to a docking strand, directly or indirectly, and wherein each antigen-specific binding partner is linked to one or more optical labels, and wherein antigen-specific binding partners of different specificity are linked to distinct optical labels, (4) optionally removing unbound antigen-bound imager strands and/or antigen-specific binding partners, (5) imaging the sample to detect bound labeled antigen-specific binding partners, (6) optionally removing/extinguishing signal from the optical labels, and (7) optionally repeating steps (1)-(6), or any subset thereof.
US11920181B2
Some aspects of this disclosure provide strategies, methods, and reagents for determining nuclease target site preferences and specificity of site-specific endonucleases. Some methods provided herein utilize a novel “one-cut” strategy for screening a library of concatemers comprising repeat units of candidate nuclease target sites and constant insert regions to identify library members that can been cut by a nuclease of interest via sequencing of an intact target site adjacent and identical to a cut target site. Some aspects of this disclosure provide strategies, methods, and reagents for selecting a site-specific endonuclease based on determining its target site preferences and specificity. Methods and reagents for determining target site preference and specificity are also provided.
US11920178B2
The present invention relates to the use of type III polyketide synthases of bacteria, such as actinomycete bacteria, as phloroglucinol synthases. The present invention also relates to the isolated nucleic acid molecules encoding these type III polyketide synthases, and also to the vectors and the host cells comprising such nucleic acid molecules. The present invention also relates to methods for producing phloroglucinol.
US11920167B2
The present invention provides engineered glycosyltransferase (GT) enzymes, polypeptides having GT activity, and polynucleotides encoding these enzymes, as well as vectors and host cells comprising these polynucleotides and polypeptides. The present invention provides engineered sucrose synthase (SuS) enzymes, polypeptides having SuS activity, and polynucleotides encoding these enzymes, as well as vectors and host cells comprising these polynucleotides and polypeptides. The present invention also provides compositions comprising the GT enzymes and methods of using the engineered GT enzymes to make products with β-glucose linkages. The present invention further provides compositions and methods for the production of rebaudiosides (e.g., rebaudioside M, rebaudioside A, rebaudioside I, and rebaudioside D). The present invention also provides compositions comprising the SuS enzymes and methods of using them. Methods for producing GT and SuS enzymes are also provided.
US11920163B2
The invention relates to a method for culturing a subpopulation of circulating epithelial tumour cells from a body fluid of a human or animal suffering from an epithelial tumour, wherein cells contained in the body fluid each containing at last one cell nucleus are separated from the body fluid and cultured over at least 24 hours in suspension, with formation of spheroids.
US11920155B2
Compositions comprising a population of oligodendrocyte progenitor cells (OPCs), as well as methods of making and using the same, are provided. In one aspect, a container comprising a composition, where the composition comprises a population of cells comprising a plurality of OPCs, and where the population of cells comprises less than 15% undesirable cell types is provided. In another aspect, the population of cells comprises less than 15% undesirable epithelial lineage cells. In yet another aspect, the population of cells comprises less than 2% K7 positive cells. In an aspect, a population of cells comprising a plurality of oligodendrocyte progenitor cells is capable of forming less than one epithelial cyst per 100,000 cells in a cyst assay is provided. An even further aspect of the present disclosure is a container comprising a composition, where the composition comprising a plurality of oligodendrocyte progenitor cells is useful in treating treat stroke, spinal cord injury, and multiple sclerosis.
US11920149B2
The present invention relates to nucleic acid regulatory elements that are able to enhance diaphragm-specific expression of genes, in particular expression in diaphragm as such, or in combination with expression in cardiac muscle and/or skeletal muscle, methods employing these regulatory elements and uses of these elements. Expression cassettes and vectors containing these nucleic acid regulatory elements are also disclosed. The present invention is particularly useful for applications using gene therapy, more particularly diaphragm-directed gene therapy, and for vaccination purposes.
US11920146B2
The disclosure provides nucleic acids, and variants and fragments thereof, obtained from strains of Bacillus thuringiensis encoding polypeptides having pesticidal activity against insect pests, including Lepidopteran and Coleopteran. Particular embodiments of the disclosure provide isolated nucleic acids encoding pesticidal proteins, pesticidal compositions, DNA constructs, and transformed microorganisms and plants comprising a nucleic acid of the embodiments. These compositions find use in methods for controlling pests, especially plant pests.
US11920143B2
The present disclosure discloses an AtPPR1 gene (negative regulatory factor) for Phytophthora resistance and homologous genes thereof, involving an AtPPR1 gene and a protein encoded by the AtPPR1 gene. The AtPPR1 gene has a nucleotide sequence of SEQ ID NO:6, and the protein encoded by the AtPPR1 gene has an amino acid sequence of SEQ ID NO:7. A function of the AtPPR1 gene of the present disclosure to improve Phytophthora resistance of plants can be used for the selective breeding of Phytophthora-resistant varieties. As a new type of negative immunoregulatory factor in plants, AtPPR1 negatively regulates the resistance of plants to Phytophthora by interfering with downstream signal transduction of endogenous jasmonic acid (JA) and salicylic acid (SA) and ROS signals in plants.
US11920134B2
The invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of a RRM2 gene. The invention also relates to a pharmaceutical composition comprising the dsRNA or nucleic acid molecules or vectors encoding the same together with a pharmaceutically acceptable carrier; methods for treating diseases caused by the expression of a RRM2 gene using said pharmaceutical composition; and methods for inhibiting the expression of RRM2 in a cell.
US11920116B2
The presently disclosed subject matter provides systems and methods for producing a three-dimensional model of a human cervix. A microdevice is provided for culturing human cervical cells. The microdevice can include an upper microchannel including live ectocervical epithelial cells. The microdevice can include a lower microchannel including a first parallel lane and a second parallel lane including stromal media. The first and the second parallel lanes can be lined with live vascular endothelial cells. The lower microchannel can include a third parallel lane including uterine fibroblasts and live smooth muscle cells embedded in hydrogel. The first, second, and third lanes of the lower microchannel can be separated by protrusion structures. The third parallel lane can be positioned in the lower microchannel in between the first and the second parallel lanes. The microdevice can further include a porous membrane positioned in between the upper microchannel and the lower microchannel.
US11920115B2
An array of magnetic or paramagnetic micro-elements comprised of polysilsesquioxane is described having ultra-low-autofluorescence and other optical properties to improve microscopic imaging of cells or other objects present on the array. These materials are also amenable to chemical modification allowing surface attachment of affinity capture moieties or chemical reporters for selective binding or analysis of cells, macromolecules or other targets.
US11920114B2
A culture module is contemplated that allows the perfusion and optionally mechanical actuation of one or more microfluidic devices, such as organ-on-a-chip microfluidic devices comprising cells that mimic at least one function of an organ in the body. A method for pressure control is contemplated to allow the control of flow rate (while perfusing cells) despite limitations of common pressure regulators. The method for pressure control allows for perfusion of a microfluidic device, such as an organ on a chip microfluidic device comprising cells that mimic cells in an organ in the body, that is detachably linked with said assembly, so that fluid enters ports of the microfluidic device from a fluid reservoir, optionally without tubing, at a controllable flow rate.
US11920113B1
A semi-automated vessel-in-vessel beer brewing and precision timed cooking system is disclosed. This system enables automated, hands-off brewing from strike to boil, more efficient sparging, and precision timed cooking, and can be built as an add-on to existing vessel-in-vessel systems.
US11920106B2
A method for producing a multiphase washing or cleaning agent shaped body, including the steps of: a) providing a first free-flowing washing or cleaning agent; b) providing a second washing or cleaning agent; c) feeding the first and second washing or cleaning agent to an injector; d) introducing the first free-flowing washing or cleaning agent and the second free-flowing washing or cleaning agent into a mold by way of the injector; e) solidifying at least one of the free-flowing first and second washing or cleaning agents in the mold, forming a multiphase washing or cleaning agent shaped body; f) removing the multiphase washing or cleaning agent shaped body from the mold, wherein the first and second free-flowing washing or cleaning agent are introduced into the mold through outlet openings in the injector, which are separated. The invention also relates to multiphase shaped bodies produced by way of this method.
US11920104B2
The present invention relates to the use of an ether or an ester of a 1-substituted cycloalkanol or of mixtures of two or more ethers or esters of 1-substituted cycloalkanols or of a stereoisomer thereof or of a mixture of two or more stereoisomers thereof as aroma chemicals; to the use thereof for modifying the scent character of a fragranced composition; to an aroma chemical composition containing an ether or an ester of a 1-substituted cycloalkanol or of mixtures of two or more ethers or esters of 1-substituted cycloalkanols or of a stereoisomer thereof or of a mixture of two or more stereoisomers thereof; and to a method of preparing a fragranced composition or for modifying the scent character of a fragranced composition. The invention further relates to specific ethers or esters of 1-substituted cycloalkanols.
US11920091B2
The subject invention provides microbe-based products, as well as their use to improve oil production and refining efficiency by, for example, remediating the disposable layers in oil tanks and other oil storage units. In preferred embodiments, the microbe-based products comprise biochemical-producing yeast and growth by-products thereof, such as, e.g., biosurfactants. The subject invention can be used to remediate rag layer and/or other dissolved solid layers that form in water-oil emulsions. Furthermore, the subject invention can be used for remediating solid impurities, such as sand, scale, rust and clay, in produced water, flow-back, brine, and/or fracking fluids.
US11920086B1
A variety of methods and compositions are disclosed, including, in one embodiment, A friction reducer comprising: a continuous phase comprising a base oil and a secondary oil, wherein the secondary oil is different than the base oil; a discontinuous phase dispersed in the continuation phase, wherein the discontinuous phase comprises water and a water-soluble polymer; and an emulsifying surfactant.
US11920080B2
Provided are wellbore treatment fluids and methods to introduce these treatment fluids in a subterranean formation. The treatment fluids include a diverter material and an aqueous carrier fluid. Further, the diverter material comprises a composite material of a polyvinyl alcohol and a plasticizer. The diverter material includes particles having a particle size distribution of about 2 to about 10 U.S. mesh and an aspect ratio of 20:1 or less. The treatment fluid is introduced into a permeable zone of a subterranean formation, wherein the permeable zone is part of a wellbore that is permeated or penetrated by fractures and fissures. The diverter material diverts at least partially the treatment fluid to a different portion of the subterranean formation.
US11920075B2
The present invention relates to a liquid-crystalline medium (LC medium), to the use thereof for electro-optical purposes, and to LC displays containing this medium.
US11920073B2
The present disclosure discloses an etching composition. The etching composition includes: a component A: oxidizing agent 1-30 wt %; a component B: inorganic acid 0.5-20 wt %; a component C: organic acid 0-15 wt %; a component D: chelating agent 0.01-15 wt %; a component E: ionic compound and/or other inorganic acids except the inorganic acid in the component B 0-0.1 wt %; and deionized water.
US11920069B2
Compositions containing at least one sort of semiconducting nanoparticle, at least one antioxidant, a polymerizable component, a liquid organic compound and an organic additive of formula (II) wherein M is a divalent metal ion; and R1 and R2 are, each independently, a straight chain alkyl group having 1 to 16 carbons atoms, or a straight chain alkenyl group having 2 to 15 carbon atoms or branched chain alkyl or alkenyl group having 3 to 15 carbon atoms, and polymer or composite layers formed therefrom, optical devices containing the layers and their preparation and method of use, as well as a method to improve at least one feature of a quantum material or a quantum material layer.
US11920068B2
A method of manufacturing a wavelength conversion member that includes a sintered body having a light incidence face, a light emission face, and a light reflecting face different from the light incidence face and the light emission face, the method comprising: providing a sintered body containing inorganic particles and phosphor particles, and forming a plurality of recessed portions on the light reflecting face of the sintered body, which comprises acid treating the sintered body.
US11920065B2
A self-adhesive article comprises an adhesive layer comprising a crosslinked adhesive composition, which comprises at least one polysilylated polymer having a number-average molar mass (Mn) of at least 20000 g/mol, wherein the at least one polysilylated polymer comprises a polyether and/or polyurethane main chain and at least two hydrolysable silylated end groups, said silylated end groups being attached to the main chain of the polymer by a urethane or ether function (referred to as a connector group); at least one tackifying resin having an average hydroxyl number of less than or equal to 100; and at least one crosslinking catalyst, excluding any monosilylated polymer.
US11920060B1
New diorganyl diselenide compounds are described herein, as well as the use of such diorganyl diselenide compounds in forming anticorrosion coatings for stainless steel. Also described are methods for forming the new diorganyl diselenide compounds as well as anti-corrosion coatings containing the diorganyl diselenide compounds.
US11920059B2
A coating material is allowed to contain a sulfate having a higher degree of solubility in water than that of calcium sulfate. The sulfate is an additive for coating materials which is used for reducing the consumption of zinc (including zinc oxide) in a coating film formed from the coating material and the corrosion of a base material when the coating film is scratched. The content of the sulfate can be 0.004 to 0.65 mol per 100 g of the content of zinc. Alternatively, the content of the sulfate may be 0.006 to 0.186 mol per 100 g of a heating residue (except for the sulfate added) of a coating film.
US11920051B2
A composition comprising a silane compound represented by Formula 1 comprising a fluorine-containing (poly)ether group; and an amine compound represented by Formula 2 comprising a fluorine-containing (poly)ether group: Rfa-(L1)p1-Q1-(L2)p2-Si(R1)(R2)(R3) Formula 1 Rfb-(L3)p3-Q2-(L4)p4-N(R4)(R5) Formula 2 wherein Rfa, Rfb, Q1, Q2, L1 to L4, R1 to R3, R4 to R5, and p1 to p4 are as disclosed herein.
US11920045B2
To provide an active-energy-ray-curable composition including a compound represented by General Formula (I) below: where in the General Formula (I), R is hydrogen or a methyl group; A is a structure expressed by one selected from the group consisting of Structural Formulas (II) to (VII) below, each of which may have a substituent such as an alkyl group or an alkoxy group, or both; j and k in the Structural Formulas (VI) and (VII) are an integer of 0 or more; X denotes a substituent including a heteroatom; n is an integer of 0 or more, m is an integer of 1 or more, and n+m is 3 or more, or n is an integer of 0 and m is an integer of 2; and wavy lines in the Structural Formulas (II) to (VII) each independently denote a bond with X or a (meth)acryloyl group (H2C═CR—C(═O)—):
US11920044B2
A method of making an ink for use in additive manufacturing of a self-healing product includes providing a thiol material. The method further includes oxidizing the thiol material to form a thiol-disulfide oligomer. The method further includes applying an alkene material to the thiol-disulfide oligomer to allow a thiol-ene reaction and form a self-healing ink embedded with a disulfide bond.
US11920039B2
Derivatized malachite green leuco dyes for use in radio-chromic systems are described. The dyes have the following structure: in which Ar is a substituted phenyl or thiophene ring in which at least one substitution of the Ar ring is not ortho to the bond between the ring and the linking carbon, and in which R1, R2, R3, and R4 are independently selected from methyl, alkyl, or alkyl halide. The systems include the dyes in conjunction with an activator, e.g., a halogenated activator, and a carrier, e.g., a fluid carrier or an encapsulating polymeric matrix.
US11920037B2
Some embodiments relate to a method for producing a rubber-containing asphalt composition. The method for producing the rubber-containing asphalt composition comprises obtaining a rubber component; obtaining an unoxidized asphalt; mixing the rubber component and the unoxidized asphalt to obtain an unoxidized asphalt composition; oxidizing the unoxidized asphalt composition to obtain an oxidized asphalt composition; and forming a roofing shingle from the oxidized asphalt composition.
US11920026B2
Disclosed herein is a novel polymer having a structure based on a biodegradable polymer. In the novel polymer, the biodegradable polymer has at least one kind of functional groups from among a hydroxyl group and a carboxyl group, wherein the biodegradable polymer bears a functional group conjugated with a nitric oxide-releasing compound and a different functional group substituted with a photopolymerizable functional group, the nitric oxide-releasing compound comprising a NO donor. Also provided is a nanofiber fabricated from the modified biodegradable polymer. The nanofiber can be fabricated by electrospinning the novel polymer.
US11920013B2
Coated shaped articles contain at least one shaped article with foamed beads containing at least one polyurethane (A) and at least one coating containing at least one polyurethane (B), wherein polyurethane (A) and polyurethane (B) are each constructed from at least one polyol and at least one polyisocyanate and wherein not less than 50 wt % of the polyol component used for constructing polyurethane (A) and polyurethane (B) is identical and not less than 50 wt % of the at least one polyisocyanate component used for constructing polyurethane (A) and polyurethane (B) is identical. Processes for producing the coated shaped articles and the method of using the coated shaped articles for various applications can be utilized.
US11920005B2
A high-efficiency, low-energy consumption and environmental-friendly recycling technology for PETE plastic waste is disclosed. The degradation of PETE plastic waste includes a method for attacking the —O— ester linkage in the repeat unit of PETE plastic with water in saturated pressure and CO2 in supercritical (Sc) conditions.
US11919999B2
Provided are a method for preparing a polyetherketoneketone and a polyetherketoneketone prepared thereby, wherein, at the time of a polymerization reaction, nitrogen gas is blown into a liquid reaction medium while stirring, thereby quickly removing hydrochloric acid, which is a by-product generated during the reaction, and preventing aggregation of resin particles, thus suppressing the generation of scales.
US11919986B2
The present invention provides an antifouling ability-imparting agent that adheres well to a variety of water treatment membranes such as reverse osmosis membranes and imparts excellent antifouling ability to the water treatment membranes. The present invention relates to an antifouling ability-imparting agent containing a copolymer, the copolymer containing: a structural unit (I) represented by the following formula (1): wherein R1 is a hydrogen atom or a methyl group; R2 is a direct bond, —CH2—, —CH2CH2—, or —CO—; R3s are the same as or different from each other and are each a C1-C20 alkylene group; X is —CH2CH(OH)CH2(OH) or —CH(—CH2OH)2; and n is a number of moles of oxyalkylene groups added and is 0 to 100; and a structural unit (II) represented by the following formula (2): wherein R4 is a hydrogen atom or a methyl group; R5 is a direct bond, —CH2—, —CH2CH2—, or —CO—; R6s are the same as or different from each other and are each a C1-C20 alkylene group; R7 is a hydrogen atom or a C1-C20 alkyl group; and m is a number of moles of oxyalkylene groups added and is 1 to 100.
US11919985B2
Provided is a copolymer that can be favorably used as a main chain scission-type positive resist that has excellent heat resistance and that can form a resist pattern having excellent resolution and clarity. The copolymer includes a monomer unit (A) represented by the following formula (I) and a monomer unit (B) represented by the following formula (II), and has a molecular weight distribution of 1.7 or less. In the formulae, L is a single bond or a divalent linking group, Ar is an optionally substituted aromatic ring group, R1 is an alkyl group, R2 is an alkyl group, a halogen atom, or a haloalkyl group, p is an integer of not less than 0 and not more than 5, and in a case in which more than one R2 is present, each R2 may be the same or different.
US11919975B2
The present invention relates to a process for producing a low endotoxin alkali chitosan, chitin, chitosan derivative or chitin derivative, and also to a process for producing low endotoxin neutral chitosan, chitosan salt and chitosan derivatives, and to the products of such processes. The process comprises contacting chitosan, chitin, chitosan derivative or chitin derivative with an alkali solution to form a mixture; leaving the mixture for a period of less than 1 hour and optionally drying the mixture. The low endotoxin alkali chitosan may be used in the manufacture of other useful chitosan based products.
US11919960B2
The present disclosure provides antibody sequences found in antibodies that bind to human CD25. In particular, the present disclosure provides sequences of anti-human CD25 antibodies, which do not block the binding of CD25 to IL-2 or IL-2 signalling. Antibodies and antigen-binding portions thereof including such sequences can be used in 5 pharmaceutical compositions and methods of treatment, in particular for treating cancer.
US11919951B2
The invention relates to antibodies directed against an epitope located within the C-terminal portion of CLDN6 which are useful, for example, in diagnosing cancer and/or in determining whether cancer cells express CLDN6.
US11919945B2
This disclosure provides novel broadly neutralizing anti-SARS-CoV-2 antibodies or antigen-binding fragments thereof. The disclosed anti-SARS-CoV-2 antibodies constitute a novel therapeutic strategy in protection against SARS-CoV-2 infections.
US11919942B2
The present application provides methods and processes for making and using a fibronectin composition, as well as methods for treating ocular conditions and/or disorders with the cellular fibronectin composition described herein.
US11919941B2
Soluble, self-assembling collagens derived from tissues are extensively characterized such that one can predict and customize the final collagen-fibril matrix with respect to fibril microstructure (i.e., fibril density, interfibril branching), viscoelasticity and proteolytic degradability. As shown herein these matrices template and direct the deposition of mesoporous silica at the level of individual collagen fibrils. The fibril density, silicic acid concentration, and time of exposure to silicifying solution were varied and the resulting hybrid materials were analyzed by scanning electron microscopy, energy-dispersive x-ray spectroscopy, and rheology. Microstructural properties of the collagen-fibril template are preserved in the silica surface of hybrid materials. Results for three different collagen fibril densities, corresponding to shear storage moduli of 200 Pa, 1000 Pa, and 1600 Pa, indicate that increased fibril density increases the absolute amount of templated silica when all other silica synthesis conditions are kept constant. The mechanical properties of the hybrid material are dominated by the presence of the silica coating rather than the starting collagen matrix stiffness.
US11919939B2
The invention provides an isolated peptide containing a motif that binds antiphospholipid antibodies (aPLA) and that is recognized by CD4+ T cells that are able to induce production of antiphospholipid antibodies (aPLA). The present invention further provides methods for detection of aPLA and CD4+ T cells able to induce production of aPLA. The present invention also provides methods for treating the antiphospholipid syndrome (APS).
US11919937B2
Provided are T cell receptors (TCR) and TCR variable regions that can selectively bind the T-cell leukemia/lymphoma 1 (TCL1) oncoprotein. The TCR may be utilized in various therapies, such as autologous TCL1-TCR adoptive T cell therapy, to treat a cancer, such as a B-cell malignancy or a solid tumor expressing TCL1. Methods for expanding a population of T cells that target TCL1 are also provided.
US11919934B2
Disclosed herein are interleukin (IL) 15 conjugates and use in the treatment of one or more indications. Also described herein include pharmaceutical compositions and kits comprising one or more of IL-15 conjugates.
US11919932B2
Disclosed are a novel therapeutic means effective and practical against cancer, and a novel substance useful as such a therapeutic means. Provided are novel peptides derived from a partial region of HMGN1, HMGN2, HMGN4 or HMGN5, and anti-cancer agents and anti-cancer effect enhancers containing the peptide as an active ingredient. The peptide of the present invention has an anti-tumor effect even independently, and exerts a remarkably excellent anti-tumor effect particularly when used in combination with an immune checkpoint regulator, or an anti-CD4 antibody or antigen-binding fragment thereof.
US11919930B2
Provided is an insect odorant receptor co-receptor that exhibits excellent detection sensitivity to an odorous substance when bound to an odorant receptor to form an odorant receptor complex. The odorant receptor co-receptor includes a first amino acid sequence and a second amino acid sequence subsequently to the farthest carboxyl-terminal amino acid residue of the first amino acid sequence.
US11919903B2
The invention relates to polymorphous crystal modifications of a DPP-IV inhibitor, the preparation thereof and the use thereof for preparing a medicament.
US11919898B2
A crystal form of an azaindole derivative and a preparation method thereof are disclosed.
US11919897B2
Compounds of Formula I, including pharmaceutically acceptable salts thereof, and compositions and methods for treating human immunodeficiency virus (HIV) infection are set forth:
US11919878B1
An 9-(2-hydroxypyridin-3-yl)-10-(2-phenyletnyl)-3,3,6,6-tetramethyl-3,4,6,7,9,10-hexahydroacridine1,8(2H,5H)-dione compound, its synthesis, and its use as an antimicrobial agent.
US11919876B2
Processes and systems for producing olefin epoxides with three or more carbon atoms by oxidation of the corresponding branched hydrocarbons using oxygen are disclosed. An example process for producing olefin epoxides may include oxidizing a branched alkane to produce at least an organic hydroperoxide. The example process may further include epoxidizing a branched alkene by a catalytic reaction with least a portion of the organic hydroperoxide to produce at least an olefin epoxide and an alcohol. The example process may further include converting at least a portion of the alcohol to either additional branched alkane and/or additional branched alkene.
US11919871B1
A 3-(3-chlorophenyl)-5-((2-isopropyl-5-methylphenoxy)methyl)-1,2,4-oxadiazole compound, its synthesis, and its use as an antimicrobial agent.
US11919870B2
Aminocyclobutane compounds of Formula (I), and pharmaceutically acceptable salts, isotopes, N-oxides, solvates, and stereoisomers thereof, pharmaceutical compositions containing them, and methods of using them including methods for treating disease states, disorders, and conditions associated with MGL modulation, such as those associated with pain, psychiatric disorders, neurological disorders (including, but not limited to major depressive disorder, treatment resistant depression, anxious depression, autism spectrum disorders, Asperger syndrome, bipolar disorder), cancers and eye conditions: wherein X, R1, R2a, R2b, R3 and R4 are defined herein.
US11919869B2
Provided herein is A compound of Formula I: or a pharmaceutically acceptable salt thereof, wherein the various substituents are described herein.
US11919863B2
The disclosure is directed to improved methods for preparing substituted quinolinylcyclohexylpropanamide compounds.
US11919861B1
A 6′-(2-bromophenyl)-2′-ethoxy-3,4′-bipyridine-3′-carbonitrile as antioxidant compound, its synthesis, and its use as an antioxidant agent.
US11919859B2
Disclosed is a mixture comprising (a) a compound of Formula I and salts thereof wherein A1, A2, A3, R1, B1, B2 and B3 are defined in the disclosure, and (b) 2-pyridinecarboxylic acid, 4-amino-3-chloro-6-(4-chloro-2-fluoro-3-methoxyphenyl)-5-fluoro-, phenylmethyl ester (i.e. florpyrauxifen-benzyl). Also disclosed is a composition comprising the mixture. Also disclosed is a method of applying the mixture to undesired vegetation comprising contacting the undesired vegetation or its environment with an effective amount of the mixture of the invention.
US11919858B2
The invention relates to compounds of formula (I) with low cytotoxicity for blocking the ubiquitination-proteasome system in diseases. Accordingly, these compounds can be used in treatment of disorders including, but not limited to, cancers.
US11919857B2
The present invention discloses a phthalide derivative, the structure of said derivative is represented by Formula (I) or Formula (II). The present invention also discloses the preparation method and use of said derivative. The phthalide compound obtained through structure modifications in the present invention enhances the chemical stability and pharmacological activity of the phthalide compound, facilitating the improvement of the druggability of such compounds.
US11919856B2
The present invention relates to compounds, compositions, combinations and medicaments containing said compounds and processes for their preparation. The invention also relates to the use of said compounds, combinations, compositions and medicaments, for example as modulators of alpha I antitrypsin and treating diseases associated with alpha antitrypsin, particularly liver diseases.
US11919852B2
The invention relates to a process for separating a component mixture (K) comprising hydrogen, methane, hydrocarbons having two carbon atoms and hydrocarbons having three or more carbon atoms, wherein in a deethanization at least a portion of the component mixture (K) is subjected to a first partial condensation by cooling from a first temperature level to a second temperature level at a first pressure level to obtain a first gas fraction (G1) and a first liquid fraction (C1), at least a portion of the first gas fraction (G1) is subjected to a second partial condensation by cooling from the second temperature level to a third temperature level at the first pressure level to obtain a second gas fraction (G4) and a second liquid fraction (C2), and at least a portion of the first liquid fraction (C1) and at least a portion of the second liquid fraction (C2) are subjected to a rectification to obtain a third gas fraction (G3) and a third liquid fraction (C3+). The first liquid fraction (C1) or its part subjected to the rectification and the second liquid fraction (C2) or its part subjected to the rectification are expanded to a second pressure level and the rectification is carried out at the second pressure level, the first pressure level being 25 to 35 bar and the second pressure level being 14 to 17 bar. An overhead gas formed during the rectification is cooled to −25 to −35° C. and partially condensed, wherein a condensed portion of the overhead gas is used partially or completely as a reflux in the rectification and an uncondensed portion of the overhead gas is provided partially or completely as the third gas fraction (G3). The present invention likewise provides a corresponding plant (100, 200).
US11919838B2
This invention provides, but is not limited to, novel oleanolic acid derivatives having the formula: wherein the variables are defined herein. Also provided are pharmaceutical compositions, kits and articles of manufacture comprising such compounds, methods and intermediates useful for making the compounds, and methods of using the compounds and compositions.
US11919837B1
An 4,4′-naphthalene-1,5-diylbis(diazene-2,1-diyl)dinaphthalen-1-ol compound, its synthesis, and its use as an antioxidant agent.
US11919836B2
Disclosed herein are pharmaceutical compositions comprising fencamfamine or fencamfamine related prodrug derivatives for targeted therapeutic applications and methods of synthesizing the compositions.
US11919831B2
Phase-stabilized ammonium nitrate (PSAN) prill including ammonium nitrate and a potassium salt are provided. The PSAN prill can be explosive grade and low density. The PSAN prill may include a porosity enhancing agent such as an interfacial surface modifier or a pore former. Methods of preparing the PSAN prill and related emulsions are also provided.
US11919823B2
In various embodiments, a process is described for the preparation of a concrete mixture in a Ready-mix or for an installation. A quantity of amorphous silica is added with an average particle size in the range of from about 1 to about 55 nanometers and/or wherein the surface area of the particles of the amorphous silica is in the range of from about 300 to about 900 m2/g. The amorphous silica may be added in colloidal form or otherwise, and is added at a particular stage to ensure efficacy.
US11919821B2
A void filler material includes a ceramic rod and a fibrous overwrap. The void filler material may be used in a ceramic matrix composite. The method of making the ceramic matrix composite includes inserting the void filler material in voids of a preform and depositing a ceramic matrix on the preform and the void filler material using chemical vapor infiltration.
US11919817B2
A process for manufacturing a ceramic powder with binder includes at least one additional element or compound, the ceramic powder with binder being in particular based on zirconia and/or alumina and/or strontium aluminate, wherein the process includes a step (E3) of depositing at least one additional element or compound on a ceramic powder with binder by a physical vapour deposition (PVD) and/or by a chemical vapour deposition (CVD) and/or by an atomic layer deposition (ALD).
US11919816B2
A filter including a porous support defining one or more channels therethrough, and a porous ceramic membrane layer on a surface of the porous support defining at least one of the one or more channels. The ceramic membrane layer includes an inorganic ceramic composition having the formula SiMpxpCyNzOmHn, where each Mp present is independently selected from a p-block element or a d-block element; p is an integer from 1 to 5; for each Mp present, xp is independently from about 0 to about 60; y is from about 0 to about 60; z is from about 0 to about 60; m is from about 0 to about 40; and n is zero or nonzero. At least one of y and z is nonzero when p is zero, and p is nonzero when y and z are both zero.
US11919813B2
A lime-based cement extender composition, and associated systems and methods are disclosed herein. In some embodiments, the lime-based cement extender composition includes 5-20% by weight lime particles, 40-50% by weight limestone particles, and 40-50% by weight pozzolan particles. Additionally or alternatively, the lime-based cement extender composition can comprise a calcium oxide concentration of 45-65%, a magnesium oxide concentration of 0.5-2%, an iron oxide concentration of 0.5-2.0%, an aluminum oxide concentration of 2-8%, a silicon dioxide concentration of 20-40%, a potassium oxide concentration of 20,000-30,000 ppm, and a sodium oxide concentration of 10,000-20,000 ppm. In some embodiments, the lime-based cement extender composition, or product, is combined with cement to produce a cement blend for use in the mining industry as mine backfill.
US11919809B2
A reinforced concrete material is described comprising a cementitious material (22) in which graphene is substantially uniformly distributed. A method of production of concrete is also described comprising the steps of forming a substantially uniform suspension (20) of graphene with water, and mixing the suspension (20) with a cementitious material (22) to form a concrete material (28).
US11919806B2
Provided is a glass having an excellent infrared transmittance and suitable for use in infrared sensors. An infrared transmitting glass containing, in terms of % by mole, over 0 to 50% Ge, over 0 to 50% Ga, over 0 to 50% Si, 20 to 90% Te, 0 to 40% Ag+Al+Ti+Cu+In+Sn+Bi+Cr+Sb+Zn+Mn, and 0 to 40% F+Cl+Br+I.
US11919805B2
A silica-based substrate includes a glass phase and a dispersed phase having carbon, such that the silica-based substrate has a thickness of at least 10 gm. Also disclosed is a method of forming a silica-based substrate, the method including contacting a porous silica soot preform with an organic solution having at least one hydrocarbon precursor to form a doped silica soot preform and heating the doped silica soot preform in an inert atmosphere to form the silica-based substrate.
US11919789B2
A water treatment system can generate ozonated water using a vacuum operated injector with reduced vacuum switch lockup. The water treatment system includes an ozone generator, an ozone injector, a vacuum switch, and a pressure regulator. The ozone generator is configured to generate ozone. The ozone injector is coupled to the ozone generator via a hermetically sealed tubing, and the ozone injector is configured to inject the ozone into a water flow passing through the ozone injector. The vacuum switch is configured to operate the ozone generator based on a gaseous pressure inside the hermetically sealed tubing generated by the ozone injector. The pressure regulator is configured to regulate the gaseous pressure inside the hermetically sealed tubing to prevent the vacuum switch from trapped in a triggered state after the water flow stops.
US11919788B2
Methods of treating a water sample containing both free fluoride and fluorinated organic compounds are described. The methods are effective at removing high amounts of the free fluoride while retaining high amounts of the fluorinated organic compounds. The methods include combining the water sample with a hexaalkyldisiloxane, a strong acid and a compatibilizing solvent; reacting the free fluoride with the disiloxane; and removing the fluorinated reaction product.
US11919786B2
Methods and systems for the purification of an aqueous solution comprising a photocatalyst employed as an anode and a cathode in communication with an electrolyte to achieve a current flow wherein a charge is applied between the cathode and the photocatalytic excited anode a corresponding increase in electron-hole pairs occurs.
US11919774B2
A cooling absorption tower for a CO2 recovery device, comprises: an outer shell; a cooling section for cooling a flue gas, the cooling section being disposed in the outer shell; and an absorbing section configured to cause CO2 in the flue gas cooled by the cooling section to be absorbed in an absorption solvent, the absorbing section being disposed in the outer shell and above the cooling section.
US11919773B2
A method is described for treating activated carbon configured to be included in a carbon block of a filter for a water purifier. The method includes: inserting the activated carbon into a chamber; injecting ozone generated from an ozone generator into the chamber, and applying pressure to the chamber; and modifying a surface of the activated carbon inserted into the chamber based on applying the pressure to the chamber that holds the ozone and the activated carbon.
US11919766B1
A hydraulic fluid assembly having an electric motor, a hydraulic pump, hydraulic fluid reservoir, and a hydraulic fluid spill over receptacle engaged to and underneath the hydraulic fluid assembly for capturing spill over hydraulic fluid and directing such spill over to a periphery of the hydraulic fluid spill over receptacle, where the periphery is accessible and away from the hydraulic fluid assembly such that the spill over may be manually wiped up with a cloth rag instead of causing a slippery pontoon boat surface.
US11919764B2
A vehicular water processing and filling system includes a vehicular processing assembly configured to obtain and transport water; a vehicular filling assembly configured to receive water from the processing assembly; and a controller configured to: identify a presence of a container operatively adjacent to the filling assembly; determine whether an RFID tag on the container is valid; and if the RFID tag is valid, activate a flow of water from the filling assembly and into the container; wherein the processing assembly, the filling assembly, and the controller are configured to be disposed in one of a first compartmental area and a second compartmental area of a vehicle.
US11919763B2
A beverage apparatus, the beverage apparatus being hand-holdable by a user of the beverage apparatus to be portable, can include a beverage chamber housing that includes a chamber for storing a consumable liquid. The beverage apparatus can include a dispensing assembly that includes a receptacle. The receptacle can retain a vessel. The vessel can include an electronic tag and can contain an additive. The dispensing assembly can be operatively controllable by a controller to output the additive from the vessel into the consumable liquid. The beverage apparatus can include one or more sensors, devices, or assemblies that can be used to detect a volume of liquid in the chamber or a liquid level in the chamber. The beverage apparatus can include an apparatus computer processor portion (ACP) and an apparatus database portion.
US11919762B2
A capsule dispenser for bottling lines includes a motorized wheel with a horizontal axis supports sockets provided with an open end, which follow one another in receiving respective capsules in a capsule loading position and expelling them in a capsule releasing position. Their open ends are directed outward between these positions. A duct supplied with pressurized air has an arched profile about the axis of the wheel and extends externally to the sockets between the capsule loading position and the capsule releasing position. The duct has a tube which, at a lower end, bifurcates into two branches, between which the neck of the bottle is inserted just before the application of the capsule, and is provided with holes directed inwardly to blow air in the direction of the open end of the sockets.
US11919752B2
A method for securing an angular position of a crane jib displaceable in lifting and in lowering by a winch integrating a motor driving a drum on which is wound a rope and secured to a platen provided with arcuate oblong locking holes, the method including measuring a speed parameter representative of an angular speed of the jib, controlling the motor to displace the jib with a limitation of the speed parameter to a first maximum value and a limitation of a motor torque to a first limit value, until reaching an angular position in which a lock is aligned with and locked into the locking hole, and controlling the motor to displace the jib in lowering with a limitation of the speed parameter to a second maximum value and a limitation of the motor torque to a second limit value, until the speed parameter is null for a predetermined time period to stop the motor.
US11919748B2
A hoist for transferred materials in an underground auxiliary transportation system and a method thereof. The hoist includes a hoist body, guiding plates mounted at two ends of the hoist body through bolts, twist locks mounted at four ends of the hoist body, a driving unit configured to drive twist locks to rotate, transmission assemblies configured to connect the twist locks with the driving unit, ejector pins configured to prevent the twist locks from rotating mistakenly, and a sensor configured to control the hoist to operate and provide protection safety.
US11919747B2
Described herein is a hoisting block for a crane. The hoisting block includes an engaging element such as a load hook, to which a lifting tool such as a sling or a hoisting frame can be coupled. The hoisting block is provided with winches, outgoing winch cables of which are configured to carry the lifting tool to the engaging element and couple it to the engaging element. Also described herein is a crane provided with the hoisting block. The hoisting block can be applied for carrying a lifting tool to an engaging element and coupling it to the load-bearing means, or for stabilizing an engaging element relative to a support structure.
US11919746B2
A passenger transport system includes a bus system transferring data between a central control unit and a plurality of field devices. In a failure detection method, the field devices are configured in an unbranched chain configuration and the control unit transmits a test telegram to a first field device to start a monitoring cycle during which each field device receiving the test telegram forwards the test telegram to a next field device in the chain. During the monitoring cycle, the control unit monitors a communication between the field devices occurring via the bus system, in order to detect when a field device does not forward the test telegram. A data volume transmitted via the bus system during the failure detection method is significantly reduced in comparison to conventional failure tests such that failures can be recognized more quickly and/or simpler hardware and/or software can be used.
US11919740B2
A reel based closure device includes a housing, a spool positioned within the interior region of the housing, a knob that is operably coupled with the spool and with the housing, and a rotation control component that is operably coupled with the knob. The knob is rotatable in a tightening direction to cause the spool to rotate within the housing and thereby wind the tension member about the spool. The knob is also rotatable in a loosening direction to cause the spool to rotate in an opposite direction within the housing and thereby unwind the tension member from about the spool. The rotation control component is configured to prevent accidental loosening of the tension member by inhibiting rotation of the knob in the loosening direction until a sufficient rotational force is exerted on the knob in the loosening direction.
US11919738B1
A compact, open path vertical cable pulling apparatus, having a low center of gravity and composed of two detachable, single person hand-portable components. The apparatus is competent to pull cable horizontally through space underground with a pulling force in the range of at least about 20 to 100 tons using low pressure flow hydraulics and has utility in the cable pulling industries, including in the drilling and horizontal directional drilling industries, and as part of a method for pulling cable through space, including pulling cable through space in the pipe bursting and trenchless pipe replacement industries.
US11919737B2
A sheet feeding device includes a detachable separation unit, a conveyance unit, a guide member, an urging member, and an opening and closing member. The feeding unit feeds a stored sheet. The separation unit separates sheets fed by the feeding unit one by one. The conveyance unit conveys the sheet. Urged by the urging member, the guide member guides the sheet toward the conveyance unit and rotates about a first rotating shaft. The opening and closing member opens and closes. In a state in which the opening and closing member is closed, the guide member is positioned in a first position in which the guide member forms a conveyance path. In a process in which the opening and closing member is opened, a free end of the guide member moves upwardly about the first rotating shaft, by using an urging force, from the first to a second position.
US11919734B2
A method for separating blanks includes continuous conveying of a sheet metal strip in a transport direction to a laser cutting station, concurrent cutting of the sheet metal strip by at least one cutting laser, wherein a cut sheet metal strip is formed from successive sections of the same cutting geometry, transporting the cut sheet metal strip on a first conveyor belt in the transport direction, taking over the cut sheet metal strip from the first conveyor belt, transporting the cut sheet metal strip in the transport direction, separately ejecting the at least one residual blank of each section, transporting the at least one blank of each section into overlap with a second conveyor belt and ejecting the at least one blank from the suction conveyor, and transporting the blanks ejected one after the other from the suction conveyor horizontally in the transport direction to a collecting station.
US11919733B2
The invention relates to a reel (10) for winding or unwinding strip-shaped material, in particular a metal strip or the like, and to a method for tensioning a coil (12), the reel comprising a frame (13), at least one reel head (14) for disposing the coil for winding or unwinding material (11), a drive arrangement (15) having at least one electric motor (16) and a shaft (20) which connects the electric motor to the reel head, the electric motor being formed comprising a stator (17) and a rotor (18) and being disposed on the frame, the electric motor being a torque motor or a synchronous motor, the shaft directly connecting the rotor to the reel head, the rotor being mounted on the stator so as to be axially displaceable relative to the stator.
US11919727B2
A stacking device for handling loading aids for the automated feeding of a machine tool has a base, a stud frame that is held by the base and that supports a first vertical guide and a second vertical guide, and a first side and a second side. The first side has a vertically movable support segment for receiving a conveyor that carries two or more loading aids that are arranged one above the other. The support segment is moveable along the first vertical guide. The second side has a vertically movable lifting console for receiving at least one loading aid. The lifting console is configured to receive two or more loading aids arranged one above the other. The lifting console is moveable along the second vertical guide. The support segment and the lifting console are arranged facing away from each other at the stud frame. The support segment and the lifting console are coupled to each other in a forced coupling via a common coupling member and vertically movable in opposite directions via a common vertical drive. An automation module includes a stacking device and a handling unit. A method for feeding a machine tool uses such a stacking device.
US11919718B1
An assembly includes a frame and a conveyor mat configured to transition between a retracted state in which the conveyor mat is disposed within a footprint of the frame, and a deployed state in which the conveyor mat is disposed at least partially disposed outside the footprint of the frame. The conveyor mat has a plurality of linkages, a plurality of rollers, a plurality of supports, and a plurality of axles. Individual axles couple to individual linkages of the plurality of linkages, individual rollers of the plurality of rollers, and individual supports of the plurality of supports together. A tensioning system is configured to control the conveyor mat transitioning between the retracted state and the deployed state.
US11919711B2
An automated storage and retrieval system includes at least one relay module for relaying storage containers between a port column and an access station. The relay module is arranged below a port column. The relay module includes a port station, a first conveyor, a second conveyor, each arranged at a side of the port station, and a lateral displacement device. The port station arranged at a lower end of the port column receives storage containers dropped off from and to be picked up through the port column. The first conveyor is adapted to transport storage containers to an access station. The second conveyor is adapted for transporting storage containers from the access station. The lateral displacement device is coupled to the port station and is arranged to transport storage containers between the port station and the first conveyor, and between the second conveyor and the port station.
US11919699B2
A box includes a side wall including an outer side panel; an inner side panel positioned parallel to the outer side panel; and a connecting strip defining a first edge and a second edge, the first edge connected to the outer side panel by a first fold line, the second edge connected to the inner side panel by a second fold line, the connecting strip defining a trapezoidal shape; and a bottom wall coupled to the side wall.
US11919698B2
A packaging system included a support member and a packing component. The support member includes a base, a head portion, and a leg. The head portion extends from the base in a first direction. The leg extends from the base in a second direction opposite the first direction. The packing component includes a first portion and a second portion. The first portion defines a first aperture configured to receive the leg. The second portion defines a second aperture configured to receive the head portion.
US11919692B2
A carrier for holding a plurality of containers includes a plurality of panels that includes at least one central panel and at least one attachment panel configured to receive a portion of one or more containers of the plurality of containers. The at least one central panel includes a plurality of openings and is for being positioned between and attached to adjacent containers of the plurality of containers.
US11919686B1
A container for housing a liquid-filled bag has at least four walls including first and second side walls, a front wall, and a back wall. The front wall has a front wall panel, and the back wall has a back wall panel interconnected with first and second side wall panels. A first inner shield flap is coupled to the front wall panel, a second inner shield flap is coupled to the back wall panel, and a first top flap is coupled to the first side wall panel. The first top flap defines a first handhold opening. A second top flap is coupled to the second side wall panel and defines a second handhold opening. The first and second handhold openings overlap to define a handhold when the second top flap is folded over the first top flap. The handhold is offset from free ends of the first and second inner shield flaps.
US11919683B2
A method of processing boxes includes shuttling a box in a first direction and cutting to separate outer flaps of the box from one another as the box moves past a cutting tool in the first direction, wherein the outer flaps overlie inner flaps. The method includes engaging a set of opening guides with the outer flaps of the box to drive the outer flaps open. The method includes opening inner flaps using shape memory and shuttling the box in the first direction over an inclined plane after the inner and outer flaps are open to flatten the box.
US11919682B1
The easy pour may comprise a paint tray cart, a paint tray, and a paint conduit. The easy pour may be a caddy that is configured to move one or more paint containers and the paint tray within a jobsite. The paint tray may detachably couple to the paint tray cart. The paint tray cart may be operable to dispense a first paint into the paint tray from a first paint container via the paint conduit such that the first paint is resupplied to the paint tray as the first paint is used. The paint tray cart may be operable to support a second paint container holding a second paint in an upright position. As non-limiting examples, the first paint container may supply a wall paint as the first paint and the second paint container may supply a trim paint as the second paint.
US11919679B2
A storage container may include a hollow main body, a lid, and an attachment mechanism for removably attaching a shackle holder. The hollow main body has a plurality of sidewalls, a first end, and a second end, opposite the first end. The lid may be disposed on the first end of the main body and the attachment mechanism may be disposed on the second end of the hollow main body. The shackle holder may be configured to retain a shackle. The shackle holder is capable of being disposed on storage containers with main bodies that vary in size.
US11919671B2
A device for removing straps from boxes, such as a strap encircling a box, includes at least one tentacle or gripping device for creating contact to a strap which is to be removed from a box, at least one first guide for guiding the strap away from the tentacle or gripping device, and at least one first guide drive for driving the first guide. A strap to be removed may be cut before or during the time a tentacle or gripping device engages with the strap.
US11919653B2
A system for fault detection and control in an electric aircraft including an inertial measurement unit, the inertial measurement unit including at least a sensor configured to detect a torque datum associated with at least a propulsor. The system includes an observer, the observer configured to generate a torque prediction datum associated with the at least a propulsor, compare the torque prediction datum with the torque datum, and generate a residual datum as a function of the comparison. The system includes a mixer, the mixer comprising circuitry configured to generate, as a function of the residual datum, a torque priority command datum and transmit, to the at least a propulsor, the torque priority command datum.
US11919649B2
A device for measuring the accretion of ice on a studied surface. The device has two arms, a first arm and a second arm, the second arm forming an enclosure for housing an image acquisition system disposed to acquire, through an orifice, images of a part of the studied surface located on the first arm. The device thus makes it possible to dissociate the support of the image acquisition system from that of the studied surface on which ice accumulates. Consequently, it is possible to place the second arm in the direction of the flow of the stream of air flowing along the aircraft while the first arm passes through the stream.
